Incidental Mutation 'R4080:Zfp667'
Institutional Source Beutler Lab
Gene Symbol Zfp667
Ensembl Gene ENSMUSG00000054893
Gene Namezinc finger protein 667
MMRRC Submission 040856-MU
Accession Numbers

Genbank: NM_001024928

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosomal Location6286579-6307883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6305106 bp
Amino Acid Change Cysteine to Glycine at position 258 (C258G)
Ref Sequence ENSEMBL: ENSMUSP00000128658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086327] [ENSMUST00000108562] [ENSMUST00000153840] [ENSMUST00000170776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086327
AA Change: C258G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083507
Gene: ENSMUSG00000054893
AA Change: C258G

KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108562
AA Change: C258G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104202
Gene: ENSMUSG00000054893
AA Change: C258G

KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153840
Predicted Effect possibly damaging
Transcript: ENSMUST00000170776
AA Change: C258G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128658
Gene: ENSMUSG00000054893
AA Change: C258G

KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Zfp667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp667 APN 7 6305397 missense possibly damaging 0.53
IGL01325:Zfp667 APN 7 6290546 missense probably damaging 1.00
IGL01386:Zfp667 APN 7 6304870 missense probably benign 0.00
IGL01960:Zfp667 APN 7 6305337 missense probably benign 0.00
IGL03394:Zfp667 APN 7 6289439 critical splice donor site probably null
B5639:Zfp667 UTSW 7 6290545 missense probably damaging 1.00
R0458:Zfp667 UTSW 7 6304845 missense probably benign 0.40
R0845:Zfp667 UTSW 7 6306092 missense possibly damaging 0.85
R1768:Zfp667 UTSW 7 6305067 missense possibly damaging 0.53
R1953:Zfp667 UTSW 7 6305088 missense probably benign 0.04
R2023:Zfp667 UTSW 7 6305417 missense possibly damaging 0.85
R3159:Zfp667 UTSW 7 6306000 missense probably damaging 1.00
R4476:Zfp667 UTSW 7 6304599 missense possibly damaging 0.53
R4584:Zfp667 UTSW 7 6290625 missense possibly damaging 0.84
R4783:Zfp667 UTSW 7 6305685 missense possibly damaging 0.83
R5037:Zfp667 UTSW 7 6305950 missense possibly damaging 0.71
R5300:Zfp667 UTSW 7 6304636 missense probably benign
R5311:Zfp667 UTSW 7 6305716 missense probably benign 0.10
R5312:Zfp667 UTSW 7 6305467 missense probably benign
R5340:Zfp667 UTSW 7 6305253 missense possibly damaging 0.53
R6262:Zfp667 UTSW 7 6304974 missense probably benign 0.03
R7386:Zfp667 UTSW 7 6305950 missense possibly damaging 0.86
R8383:Zfp667 UTSW 7 6305371 missense probably damaging 0.98
Z1177:Zfp667 UTSW 7 6304857 missense possibly damaging 0.91
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-15