Incidental Mutation 'R4080:Wfdc1'
ID316821
Institutional Source Beutler Lab
Gene Symbol Wfdc1
Ensembl Gene ENSMUSG00000023336
Gene NameWAP four-disulfide core domain 1
Synonyms2310058A03Rik, ps20
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119666365-119688222 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 119683793 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024107] [ENSMUST00000212901]
Predicted Effect probably null
Transcript: ENSMUST00000024107
SMART Domains Protein: ENSMUSP00000024107
Gene: ENSMUSG00000023336

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
WAP 56 99 1.5e-6 SMART
Predicted Effect silent
Transcript: ENSMUST00000212901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice for a null allele exhibit decreased susceptibility to influenza A virus infection and enhanced wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Wfdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Wfdc1 APN 8 119680170 missense probably damaging 1.00
IGL03384:Wfdc1 APN 8 119686277 missense probably benign 0.08
R1491:Wfdc1 UTSW 8 119666666 splice site probably null
R1711:Wfdc1 UTSW 8 119681037 missense probably benign
R4291:Wfdc1 UTSW 8 119679455 missense probably damaging 1.00
R6282:Wfdc1 UTSW 8 119679407 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGAGCTTTATTGTCCAGACAG -3'
(R):5'- AAGGACATGACTGCCCTGAG -3'

Sequencing Primer
(F):5'- GAGCTTTATTGTCCAGACAGCAGTTC -3'
(R):5'- ACTGCCCTGAGCCCCTC -3'
Posted On2015-05-15