Incidental Mutation 'R4080:Olfr1377'
ID316826
Institutional Source Beutler Lab
Gene Symbol Olfr1377
Ensembl Gene ENSMUSG00000061952
Gene Nameolfactory receptor 1377
SynonymsMOR129-1, GA_x6K02T2QP88-4453480-4452557
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50981967-50986593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50984856 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 52 (D52N)
Ref Sequence ENSEMBL: ENSMUSP00000151087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075177] [ENSMUST00000213291] [ENSMUST00000216101]
Predicted Effect probably damaging
Transcript: ENSMUST00000075177
AA Change: D52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074672
Gene: ENSMUSG00000061952
AA Change: D52N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-51 PFAM
Pfam:7tm_1 41 289 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204581
AA Change: D52N
SMART Domains Protein: ENSMUSP00000144855
Gene: ENSMUSG00000061952
AA Change: D52N

DomainStartEndE-ValueType
Pfam:7tm_4 31 237 5.9e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.9e-4 PFAM
Pfam:7tm_1 41 235 1.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213291
AA Change: D52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216101
AA Change: D52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Olfr1377
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1377 APN 11 50985003 missense possibly damaging 0.94
R1386:Olfr1377 UTSW 11 50985367 missense probably damaging 0.97
R1486:Olfr1377 UTSW 11 50984781 missense probably benign 0.00
R1613:Olfr1377 UTSW 11 50985218 missense probably damaging 1.00
R2224:Olfr1377 UTSW 11 50985232 missense probably damaging 1.00
R2411:Olfr1377 UTSW 11 50984931 missense probably damaging 0.98
R3014:Olfr1377 UTSW 11 50984707 missense probably benign 0.00
R4753:Olfr1377 UTSW 11 50985151 missense probably benign 0.05
R4764:Olfr1377 UTSW 11 50984775 missense probably benign 0.00
R4822:Olfr1377 UTSW 11 50985083 nonsense probably null
R4865:Olfr1377 UTSW 11 50985543 missense probably damaging 0.99
R5053:Olfr1377 UTSW 11 50985310 missense probably damaging 1.00
R6054:Olfr1377 UTSW 11 50984804 missense probably benign 0.00
R6368:Olfr1377 UTSW 11 50984786 missense probably benign 0.00
R7589:Olfr1377 UTSW 11 50985030 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGTTGGCAAACGACCTTACTG -3'
(R):5'- ACACTCAGGAGGAAGCCATC -3'

Sequencing Primer
(F):5'- AACGACCTTACTGGCTGGTGATAC -3'
(R):5'- GAAGCCATCCATGTTGATGAATGTG -3'
Posted On2015-05-15