Incidental Mutation 'R0391:Il17ra'
ID 31683
Institutional Source Beutler Lab
Gene Symbol Il17ra
Ensembl Gene ENSMUSG00000002897
Gene Name interleukin 17 receptor A
Synonyms VDw217, Il17r
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0391 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 120463247-120487559 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 120476979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002976]
AlphaFold Q60943
Predicted Effect probably benign
Transcript: ENSMUST00000002976
SMART Domains Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 48 198 1.3e-70 PFAM
Pfam:IL17R_fnIII_D2 199 303 9.6e-53 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:SEFIR 380 539 1.5e-51 PFAM
low complexity region 747 765 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204239
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Il17ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il17ra APN 6 120481465 missense probably damaging 1.00
IGL01413:Il17ra APN 6 120475581 missense probably benign 0.00
IGL01418:Il17ra APN 6 120475581 missense probably benign 0.00
IGL03215:Il17ra APN 6 120472114 missense probably damaging 1.00
IGL03047:Il17ra UTSW 6 120481226 missense probably damaging 1.00
PIT4305001:Il17ra UTSW 6 120481406 missense probably damaging 1.00
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0365:Il17ra UTSW 6 120478449 missense probably benign 0.03
R0470:Il17ra UTSW 6 120481806 missense probably benign 0.01
R0599:Il17ra UTSW 6 120481505 missense probably damaging 1.00
R1525:Il17ra UTSW 6 120473790 missense probably damaging 0.98
R1900:Il17ra UTSW 6 120477394 critical splice acceptor site probably null
R1972:Il17ra UTSW 6 120482216 missense probably benign 0.01
R4192:Il17ra UTSW 6 120481511 missense probably damaging 1.00
R4923:Il17ra UTSW 6 120477445 missense possibly damaging 0.94
R5009:Il17ra UTSW 6 120482207 missense probably benign 0.00
R5133:Il17ra UTSW 6 120481553 missense possibly damaging 0.81
R5411:Il17ra UTSW 6 120481442 missense probably damaging 1.00
R5548:Il17ra UTSW 6 120478473 missense probably benign 0.23
R6137:Il17ra UTSW 6 120475582 missense probably benign 0.23
R6190:Il17ra UTSW 6 120475273 missense probably damaging 1.00
R7202:Il17ra UTSW 6 120475611 missense probably benign 0.01
R7300:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8130:Il17ra UTSW 6 120478455 missense probably benign 0.01
R8152:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8213:Il17ra UTSW 6 120473034 missense probably benign 0.39
R8525:Il17ra UTSW 6 120474337 nonsense probably null
R8560:Il17ra UTSW 6 120482265 missense possibly damaging 0.78
R8675:Il17ra UTSW 6 120481988 missense probably benign 0.05
R8754:Il17ra UTSW 6 120481456 missense probably benign 0.09
R8956:Il17ra UTSW 6 120481504 missense probably damaging 1.00
R9419:Il17ra UTSW 6 120481294 missense possibly damaging 0.63
R9478:Il17ra UTSW 6 120474375 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAGCAAAGAGAGGACTGCCCATTAC -3'
(R):5'- AAGCAATCTGTGAGCGAGAGACCC -3'

Sequencing Primer
(F):5'- GCATATAAGTTCACGTCAGGC -3'
(R):5'- CCACTGTTGAACAGCATATGG -3'
Posted On 2013-04-24