Mutagenetix > Incidental Mutations

Incidental Mutation 'R0391:Il17ra'

31683

Institutional Source

Beutler Lab

Gene Symbol

Il17ra

Ensembl Gene

ENSMUSG00000002897

Gene Name

interleukin 17 receptor A

Synonyms

VDw217, Il17r

MMRRC Submission

038597-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R0391 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120463247-120487559 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 120476979 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000002976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002976]

Predicted Effect

probably benign
Transcript: ENSMUST00000002976

SMART Domains

Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:IL17R_fnIII_D1	48	198	1.3e-70	PFAM
Pfam:IL17R_fnIII_D2	199	303	9.6e-53	PFAM
transmembrane domain	321	343	N/A	INTRINSIC
Pfam:SEFIR	380	539	1.5e-51	PFAM
low complexity region	747	765	N/A	INTRINSIC
low complexity region	801	830	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204239

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

97% (97/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,701,177		probably benign	Het
Abcc2	G	A	19: 43,821,605		probably benign	Het
Abcc8	C	G	7: 46,122,173	G838A	probably damaging	Het
Akr1c21	G	A	13: 4,581,200	A245T	probably damaging	Het
Anapc15-ps	T	C	10: 95,673,277	E47G	probably damaging	Het
Apoa1	A	G	9: 46,229,842	T79A	probably benign	Het
Atp6v1b1	A	G	6: 83,756,921	H378R	possibly damaging	Het
C4b	A	G	17: 34,735,614		probably benign	Het
Catsperd	A	T	17: 56,662,821	E638D	probably benign	Het
Cckar	C	T	5: 53,706,253		probably null	Het
Cfap100	C	T	6: 90,405,339		probably benign	Het
Chd1	G	T	17: 15,749,894	G970C	probably damaging	Het
Col14a1	A	G	15: 55,446,259		probably benign	Het
Col17a1	C	T	19: 47,663,824	V698M	probably damaging	Het
Cpeb1	T	C	7: 81,361,725	D156G	possibly damaging	Het
Cryl1	A	G	14: 57,303,775	Y151H	possibly damaging	Het
Csmd3	C	A	15: 47,657,573	V1881L	probably damaging	Het
Ctnnal1	C	T	4: 56,847,921	A73T	probably damaging	Het
Cyp2c37	T	C	19: 39,994,506	S180P	probably damaging	Het
Cyp2c54	T	C	19: 40,072,169	T123A	possibly damaging	Het
Dennd6b	T	C	15: 89,187,214	D304G	probably damaging	Het
Dnmt3l	T	C	10: 78,051,916		probably benign	Het
Eci1	G	A	17: 24,433,260		probably null	Het
Efhc1	A	G	1: 20,960,188	Y115C	probably damaging	Het
Ern1	T	A	11: 106,407,178	K706*	probably null	Het
Fam129c	T	A	8: 71,602,499		probably benign	Het
Ghrl	T	C	6: 113,719,338	E31G	probably damaging	Het
Gpr108	A	C	17: 57,243,101	V179G	probably benign	Het
Henmt1	A	G	3: 108,958,535		probably benign	Het
Ift172	A	G	5: 31,286,667	V69A	probably damaging	Het
Il17rb	T	C	14: 30,004,347	N95D	probably benign	Het
Il17rb	G	T	14: 30,006,155		probably null	Het
Iqub	G	A	6: 24,446,155	L757F	probably benign	Het
Itpr1	T	C	6: 108,378,167	V473A	probably benign	Het
Itpr2	T	G	6: 146,229,773	N1978H	probably damaging	Het
Klk1b26	T	A	7: 44,012,727	F3Y	probably damaging	Het
Lars	A	G	18: 42,251,363	V50A	probably benign	Het
Lax1	G	T	1: 133,680,066	H312Q	probably benign	Het
Lctl	T	C	9: 64,122,314		probably benign	Het
Lrp2	T	A	2: 69,456,858	D3745V	probably damaging	Het
Lrp2	G	A	2: 69,460,337		probably benign	Het
Lvrn	A	T	18: 46,850,466	H92L	probably benign	Het
March1	A	G	8: 66,418,973	T385A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mbd5	T	C	2: 49,272,416	V970A	possibly damaging	Het
Mccc1	A	G	3: 35,963,570		probably benign	Het
Mpp4	A	T	1: 59,143,829		probably benign	Het
Mrnip	G	A	11: 50,199,920	A304T	probably damaging	Het
Muc5b	T	C	7: 141,865,082	S3922P	possibly damaging	Het
Myh3	T	A	11: 67,096,507		probably benign	Het
Nbea	A	T	3: 56,037,277	H555Q	probably damaging	Het
Nlrp9c	A	T	7: 26,371,476		probably benign	Het
Nmur1	A	T	1: 86,387,678	V178E	probably damaging	Het
Nod2	T	G	8: 88,663,778	S238A	probably benign	Het
Ogfod1	A	T	8: 94,063,023	T451S	probably damaging	Het
Olfr145	G	A	9: 37,897,842	G146D	probably benign	Het
Olfr23	T	C	11: 73,941,109	F288L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr716	T	A	7: 107,148,187	Y290*	probably null	Het
Pcdh20	T	C	14: 88,468,668	I399V	probably benign	Het
Pdlim1	G	T	19: 40,243,573	H120Q	probably damaging	Het
Plg	T	C	17: 12,419,081	V798A	probably damaging	Het
Polr2c	A	G	8: 94,857,775	I39V	possibly damaging	Het
Ppfia2	C	A	10: 106,830,714		probably benign	Het
Ppp1r3a	A	T	6: 14,719,697	I406N	probably benign	Het
Psg28	A	T	7: 18,426,173	M366K	probably benign	Het
Rad54b	T	C	4: 11,601,702	I419T	probably damaging	Het
Rnf43	A	G	11: 87,731,282	Q403R	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Slc28a3	A	G	13: 58,569,415		probably benign	Het
Smad2	A	T	18: 76,289,037		probably null	Het
Smad4	G	A	18: 73,658,649	P274S	probably benign	Het
Smchd1	A	T	17: 71,403,154	V906D	probably damaging	Het
Soat2	C	A	15: 102,158,753	R320S	possibly damaging	Het
Spata33	C	T	8: 123,221,887	A57V	probably damaging	Het
Stab1	A	G	14: 31,143,418	L1814P	probably benign	Het
Stab2	T	C	10: 86,947,144	K680R	probably benign	Het
Stil	A	G	4: 115,041,172		probably null	Het
Sympk	T	A	7: 19,046,849	L759H	probably benign	Het
Tet1	A	T	10: 62,814,546		probably null	Het
Tfpi2	A	T	6: 3,965,460	N117K	probably benign	Het
Tle3	A	G	9: 61,416,661	Y766C	probably damaging	Het
Trpt1	C	A	19: 6,997,930		probably null	Het
Tshz1	A	G	18: 84,016,049	F78S	possibly damaging	Het
Ttc1	T	C	11: 43,738,808	D177G	probably damaging	Het
Ttc13	T	A	8: 124,674,401	Y741F	probably damaging	Het
Ulk3	C	T	9: 57,594,832	S462L	probably benign	Het
Utrn	C	T	10: 12,525,333		probably benign	Het
V1rd19	A	C	7: 24,003,585	T159P	probably damaging	Het
Vars	T	C	17: 35,011,486	V515A	possibly damaging	Het
Vmn1r85	A	G	7: 13,084,588	Y210H	probably benign	Het
Vmn2r89	A	G	14: 51,455,978	T262A	probably damaging	Het
Vps53	G	A	11: 76,121,579	T209I	probably benign	Het
Wdfy2	T	C	14: 62,925,133	F95L	possibly damaging	Het
Wwp1	G	T	4: 19,627,911	S694Y	probably damaging	Het
Zbtb8b	T	A	4: 129,432,670	D201V	probably damaging	Het
Zmym5	A	C	14: 56,804,451	N123K	possibly damaging	Het

Other mutations in Il17ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Il17ra	APN	6	120481465	missense	probably damaging	1.00
IGL01413:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL01418:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL03215:Il17ra	APN	6	120472114	missense	probably damaging	1.00
IGL03047:Il17ra	UTSW	6	120481226	missense	probably damaging	1.00
PIT4305001:Il17ra	UTSW	6	120481406	missense	probably damaging	1.00
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0365:Il17ra	UTSW	6	120478449	missense	probably benign	0.03
R0470:Il17ra	UTSW	6	120481806	missense	probably benign	0.01
R0599:Il17ra	UTSW	6	120481505	missense	probably damaging	1.00
R1525:Il17ra	UTSW	6	120473790	missense	probably damaging	0.98
R1900:Il17ra	UTSW	6	120477394	critical splice acceptor site	probably null
R1972:Il17ra	UTSW	6	120482216	missense	probably benign	0.01
R4192:Il17ra	UTSW	6	120481511	missense	probably damaging	1.00
R4923:Il17ra	UTSW	6	120477445	missense	possibly damaging	0.94
R5009:Il17ra	UTSW	6	120482207	missense	probably benign	0.00
R5133:Il17ra	UTSW	6	120481553	missense	possibly damaging	0.81
R5411:Il17ra	UTSW	6	120481442	missense	probably damaging	1.00
R5548:Il17ra	UTSW	6	120478473	missense	probably benign	0.23
R6137:Il17ra	UTSW	6	120475582	missense	probably benign	0.23
R6190:Il17ra	UTSW	6	120475273	missense	probably damaging	1.00
R7202:Il17ra	UTSW	6	120475611	missense	probably benign	0.01
R7300:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8130:Il17ra	UTSW	6	120478455	missense	probably benign	0.01
R8152:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8213:Il17ra	UTSW	6	120473034	missense	probably benign	0.39
R8525:Il17ra	UTSW	6	120474337	nonsense	probably null
R8560:Il17ra	UTSW	6	120482265	missense	possibly damaging	0.78
R8675:Il17ra	UTSW	6	120481988	missense	probably benign	0.05
R8754:Il17ra	UTSW	6	120481456	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GAGCAAAGAGAGGACTGCCCATTAC -3'
(R):5'- AAGCAATCTGTGAGCGAGAGACCC -3'

Sequencing Primer
(F):5'- GCATATAAGTTCACGTCAGGC -3'
(R):5'- CCACTGTTGAACAGCATATGG -3'

Posted On

2013-04-24