Mutagenetix > Incidental Mutations

Incidental Mutation 'R4080:Unc5a'

316832

Institutional Source

Beutler Lab

Gene Symbol

Unc5a

Ensembl Gene

ENSMUSG00000025876

Gene Name

unc-5 netrin receptor A

Synonyms

Unc5h1

MMRRC Submission

040856-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4080 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54949411-55006018 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55004481 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 786 (T786S)

Ref Sequence

ENSEMBL: ENSMUSP00000026994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000052949] [ENSMUST00000109994] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000136852] [ENSMUST00000137967] [ENSMUST00000153665]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026994
AA Change: T786S

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876
AA Change: T786S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	296	1.25e-14	SMART
TSP1	301	350	1.98e-8	SMART
transmembrane domain	360	382	N/A	INTRINSIC
ZU5	495	598	3.68e-58	SMART
DEATH	805	896	5.86e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052949

SMART Domains

Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	232	3.7e-76	PFAM
Pfam:Hexokinase_2	234	473	1.9e-87	PFAM
Pfam:Hexokinase_1	475	674	2.2e-77	PFAM
Pfam:Hexokinase_2	676	915	2.3e-103	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109994
AA Change: T730S

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876
AA Change: T730S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
SCOP:d1biha1	44	143	1e-4	SMART
IG	155	240	1.8e-5	SMART
TSP1	245	294	1.98e-8	SMART
transmembrane domain	305	327	N/A	INTRINSIC
ZU5	439	542	3.68e-58	SMART
DEATH	749	840	5.86e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123097

SMART Domains

Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	232	3.3e-77	PFAM
Pfam:Hexokinase_2	234	457	6e-74	PFAM
Pfam:Hexokinase_1	430	629	3e-78	PFAM
Pfam:Hexokinase_2	631	870	1e-104	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126234

SMART Domains

Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	31	230	2.4e-63	PFAM
Pfam:Hexokinase_2	236	470	2.9e-62	PFAM
Pfam:Hexokinase_1	480	673	2e-69	PFAM
Pfam:Hexokinase_2	678	912	1.5e-81	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132309

SMART Domains

Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	29	164	4.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136852

SMART Domains

Protein: ENSMUSP00000116585
Gene: ENSMUSG00000025876

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
TSP1	20	70	1.23e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137967
AA Change: T61S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876
AA Change: T61S

Domain	Start	End	E-Value	Type
PDB:3G5B\|A	1	118	6e-36	PDB
Blast:DEATH	80	119	9e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142906

Predicted Effect

probably benign
Transcript: ENSMUST00000153665

SMART Domains

Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877

Domain	Start	End	E-Value	Type
Pfam:Hexokinase_1	1	177	8.5e-70	PFAM
Pfam:Hexokinase_2	179	418	9.4e-88	PFAM
Pfam:Hexokinase_1	420	619	1.2e-77	PFAM
Pfam:Hexokinase_2	621	860	1.1e-103	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC5A belongs to a family of netrin-1 (MIM 601614) receptors thought to mediate the chemorepulsive effect of netrin-1 on specific axons. For more information on UNC5 proteins, see UNC5C (MIM 603610).[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are viable through adulthood but display decreased apoptotic cell death, supernumerary neurons and morphological alterations in the embryonic cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adam7	T	C	14: 68,520,539	T245A	probably benign	Het
Adgrf3	G	A	5: 30,197,369	Q554*	probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Aspm	C	A	1: 139,470,755	Q1024K	probably damaging	Het
C7	T	C	15: 4,990,464	S734G	probably benign	Het
Ccdc158	A	T	5: 92,623,396	S987T	probably benign	Het
Chrna2	G	T	14: 66,143,417	G45V	probably benign	Het
Chrna2	C	A	14: 66,143,424	Y47*	probably null	Het
Clec2g	C	A	6: 128,981,324	Q117K	probably damaging	Het
Cntnap5a	A	G	1: 116,101,574	S253G	probably benign	Het
Cttn	T	A	7: 144,457,724	D116V	probably damaging	Het
Cyp2c40	A	G	19: 39,802,529	V286A	probably benign	Het
Dcbld2	T	A	16: 58,465,373	S632T	probably damaging	Het
Dscam	A	T	16: 96,683,772	N1118K	probably benign	Het
Eif2a	C	T	3: 58,539,629	T92M	possibly damaging	Het
Frmpd1	T	A	4: 45,284,382	C1068S	probably benign	Het
Fstl1	G	A	16: 37,822,603	V110I	probably benign	Het
Gpat2	T	C	2: 127,433,622	I465T	probably damaging	Het
Gpr137	C	T	19: 6,940,423		probably benign	Het
Hgsnat	A	G	8: 25,946,343	I561T	probably benign	Het
Ift74	T	A	4: 94,652,912		probably null	Het
Ilf3	A	G	9: 21,403,134		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc41	C	A	4: 116,080,546		probably null	Het
Myh11	C	A	16: 14,224,059	R700L	possibly damaging	Het
Myo16	A	G	8: 10,562,240	D1295G	probably damaging	Het
Myo5b	A	G	18: 74,740,488	M1488V	probably benign	Het
Naip6	A	T	13: 100,299,307	Y903N	probably damaging	Het
Nek6	A	G	2: 38,550,637	H19R	probably damaging	Het
Nktr	A	C	9: 121,741,126	T127P	probably damaging	Het
Noc4l	A	T	5: 110,649,872	D335E	probably benign	Het
Nsd1	A	G	13: 55,301,809	D1993G	probably damaging	Het
Olfr1377	G	A	11: 50,984,856	D52N	probably damaging	Het
Olfr190	A	T	16: 59,074,256	F275I	probably damaging	Het
Pabpc2	A	T	18: 39,775,530	Q616L	possibly damaging	Het
Pcdhga4	A	T	18: 37,685,779	D127V	probably damaging	Het
Phrf1	T	C	7: 141,259,720		probably benign	Het
Phtf2	T	A	5: 20,813,296	I16F	probably damaging	Het
Plekhg3	G	T	12: 76,577,981	R1200L	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prss12	A	G	3: 123,485,485	N404D	probably benign	Het
Ptch2	C	G	4: 117,111,206	A926G	probably damaging	Het
Ptpa	T	C	2: 30,443,305	F6L	probably damaging	Het
Reck	T	C	4: 43,942,293	I853T	possibly damaging	Het
Reep6	G	A	10: 80,330,162		probably benign	Het
Rex2	T	A	4: 147,058,697	S547R	probably benign	Het
Rgs22	C	T	15: 36,107,076	E55K	probably damaging	Het
Rtl6	T	C	15: 84,557,001	T65A	possibly damaging	Het
Scarb1	G	T	5: 125,277,795	P491Q	probably damaging	Het
Scfd1	A	G	12: 51,431,519	S505G	probably benign	Het
Scube1	T	G	15: 83,608,747	Q904P	probably damaging	Het
Sis	T	C	3: 72,921,184	Y1186C	probably damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Spty2d1	T	C	7: 46,998,581	E200G	probably damaging	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Sybu	T	C	15: 44,718,943	K95R	probably damaging	Het
Trappc9	T	A	15: 72,941,947	D488V	probably damaging	Het
Txk	G	A	5: 72,700,663	P381S	probably damaging	Het
Ubr2	A	T	17: 46,988,722	M198K	probably benign	Het
Unc93b1	G	A	19: 3,941,959	R231Q	probably damaging	Het
Wfdc1	T	A	8: 119,683,793		probably null	Het
Zfp667	T	G	7: 6,305,106	C258G	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Unc5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Unc5a	APN	13	54995820	missense	probably benign	0.00
IGL00339:Unc5a	APN	13	54995815	missense	possibly damaging	0.89
IGL00924:Unc5a	APN	13	55004514	missense	probably damaging	0.99
IGL01411:Unc5a	APN	13	55002928	missense	probably damaging	1.00
IGL01511:Unc5a	APN	13	55004816	missense	probably damaging	0.97
IGL02430:Unc5a	APN	13	55002482	missense	probably damaging	1.00
IGL02996:Unc5a	APN	13	54996178	missense	probably damaging	0.99
IGL03188:Unc5a	APN	13	54999503	missense	probably damaging	0.98
PIT1430001:Unc5a	UTSW	13	55003896	missense	probably damaging	1.00
PIT4378001:Unc5a	UTSW	13	54995868	missense	possibly damaging	0.95
R0009:Unc5a	UTSW	13	55002879	missense	probably damaging	1.00
R0009:Unc5a	UTSW	13	55002879	missense	probably damaging	1.00
R0028:Unc5a	UTSW	13	55003913	missense	possibly damaging	0.70
R0505:Unc5a	UTSW	13	55004954	missense	probably damaging	1.00
R0744:Unc5a	UTSW	13	55003933	missense	possibly damaging	0.92
R0745:Unc5a	UTSW	13	55005255	frame shift	probably null
R0836:Unc5a	UTSW	13	55003933	missense	possibly damaging	0.92
R1018:Unc5a	UTSW	13	54990952	missense	possibly damaging	0.81
R1432:Unc5a	UTSW	13	55004472	unclassified	probably benign
R1469:Unc5a	UTSW	13	54996419	missense	probably damaging	1.00
R1469:Unc5a	UTSW	13	54996419	missense	probably damaging	1.00
R1691:Unc5a	UTSW	13	55002924	missense	probably damaging	1.00
R2132:Unc5a	UTSW	13	54991083	missense	probably damaging	0.96
R4020:Unc5a	UTSW	13	55003369	missense	probably damaging	1.00
R4720:Unc5a	UTSW	13	55003883	missense	probably null	1.00
R4876:Unc5a	UTSW	13	54997229	missense	probably benign
R4953:Unc5a	UTSW	13	54999870	missense	probably benign	0.02
R5112:Unc5a	UTSW	13	55003418	critical splice donor site	probably null
R5593:Unc5a	UTSW	13	55004934	missense	possibly damaging	0.91
R5903:Unc5a	UTSW	13	54999690	missense	possibly damaging	0.92
R6521:Unc5a	UTSW	13	55004935	missense	probably benign	0.01
R6723:Unc5a	UTSW	13	54995889	missense	probably benign	0.23
R7038:Unc5a	UTSW	13	55004484	missense	probably damaging	1.00
R7065:Unc5a	UTSW	13	54991083	missense	probably damaging	1.00
R7241:Unc5a	UTSW	13	54991020	missense	probably damaging	1.00
R7365:Unc5a	UTSW	13	54996573	missense	possibly damaging	0.80
R7487:Unc5a	UTSW	13	54996549	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- GCTGAGAGCATAGCCATGGATG -3'
(R):5'- CCTGTCCAGGTGAAGTTTCTG -3'

Sequencing Primer
(F):5'- GAGGTGTTCTCCGTCACCAAC -3'
(R):5'- TCTGGGCTAGAGTTCGCCAG -3'

Posted On

2015-05-15