Incidental Mutation 'R4080:Naip6'
ID316834
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100299307 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 903 (Y903N)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably damaging
Transcript: ENSMUST00000042220
AA Change: Y903N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: Y903N

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118574
AA Change: Y903N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: Y903N

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
R7485:Naip6 UTSW 13 100283851 missense probably benign 0.07
R7597:Naip6 UTSW 13 100300600 missense probably benign 0.08
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACTTACATGCTCAAAGGCAG -3'
(R):5'- GAGTCACTGGAGAACATGTCTG -3'

Sequencing Primer
(F):5'- TGCTCAAAGGCAGATGTATACTCCTC -3'
(R):5'- TGAGGATTACATGAAGCTCCATCC -3'
Posted On2015-05-15