Incidental Mutation 'R4080:Dcbld2'
ID316846
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Namediscoidin, CUB and LCCL domain containing 2
SynonymsEsdn, 1700055P21Rik, CLCP1
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58408443-58469727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58465373 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 632 (S632T)
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663] [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]
Predicted Effect probably damaging
Transcript: ENSMUST00000046663
AA Change: S632T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107
AA Change: S632T

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114357
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114358
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135415
Predicted Effect probably benign
Transcript: ENSMUST00000137035
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150817
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58408873 missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58464319 missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58448526 critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58451737 missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58456402 missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58451688 missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58445359 missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58448939 missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58433445 missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58450823 missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58455145 missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R0906:Dcbld2 UTSW 16 58455247 missense probably damaging 1.00
R1184:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58465350 missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58456332 missense probably benign
R3930:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R3931:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58463066 missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58456094 missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58460976 missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58465782 missense probably benign
R4968:Dcbld2 UTSW 16 58424711 missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58455258 missense probably damaging 0.99
R5684:Dcbld2 UTSW 16 58449809 missense possibly damaging 0.90
R5737:Dcbld2 UTSW 16 58460985 missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58451756 missense probably damaging 0.97
R6277:Dcbld2 UTSW 16 58465503 missense probably damaging 1.00
R6468:Dcbld2 UTSW 16 58433373 nonsense probably null
R6753:Dcbld2 UTSW 16 58456130 missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58450763 missense probably benign 0.02
R7360:Dcbld2 UTSW 16 58465320 splice site probably null
R7555:Dcbld2 UTSW 16 58448718 intron probably null
R7570:Dcbld2 UTSW 16 58424569 missense possibly damaging 0.86
R7593:Dcbld2 UTSW 16 58424578 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCATTGATAAAACCACAGTGCC -3'
(R):5'- TTCCCACTAAAGCGTGAGGC -3'

Sequencing Primer
(F):5'- CCACGACAAAGGGTTTGGTG -3'
(R):5'- CTGGGTCCCTGCAGTTTTGAAG -3'
Posted On2015-05-15