Incidental Mutation 'R4080:Kcnh8'
ID 316850
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, C130090D05Rik, Kv12.1
MMRRC Submission 040856-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4080 (G1)
Quality Score 217
Status Not validated
Chromosome 17
Chromosomal Location 52602709-52979194 bp(+) (GRCm38)
Type of Mutation small deletion (8 aa in frame mutation)
DNA Base Change (assembly) GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA at 52725906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change at position 74 (74)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: 74
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: 74

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,498 (GRCm38) D324E possibly damaging Het
Adam7 T C 14: 68,520,539 (GRCm38) T245A probably benign Het
Adgrf3 G A 5: 30,197,369 (GRCm38) Q554* probably null Het
Aim2 T C 1: 173,459,851 (GRCm38) probably null Het
Arhgef1 G T 7: 24,925,846 (GRCm38) D850Y probably damaging Het
Aspm C A 1: 139,470,755 (GRCm38) Q1024K probably damaging Het
C7 T C 15: 4,990,464 (GRCm38) S734G probably benign Het
Ccdc158 A T 5: 92,623,396 (GRCm38) S987T probably benign Het
Chrna2 C A 14: 66,143,424 (GRCm38) Y47* probably null Het
Chrna2 G T 14: 66,143,417 (GRCm38) G45V probably benign Het
Clec2g C A 6: 128,981,324 (GRCm38) Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 (GRCm38) S253G probably benign Het
Cttn T A 7: 144,457,724 (GRCm38) D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 (GRCm38) V286A probably benign Het
Dcbld2 T A 16: 58,465,373 (GRCm38) S632T probably damaging Het
Dscam A T 16: 96,683,772 (GRCm38) N1118K probably benign Het
Eif2a C T 3: 58,539,629 (GRCm38) T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 (GRCm38) C1068S probably benign Het
Fstl1 G A 16: 37,822,603 (GRCm38) V110I probably benign Het
Gpat2 T C 2: 127,433,622 (GRCm38) I465T probably damaging Het
Gpr137 C T 19: 6,940,423 (GRCm38) probably benign Het
Hgsnat A G 8: 25,946,343 (GRCm38) I561T probably benign Het
Ift74 T A 4: 94,652,912 (GRCm38) probably null Het
Ilf3 A G 9: 21,403,134 (GRCm38) probably null Het
Klk14 G A 7: 43,692,077 (GRCm38) C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 (GRCm38) probably null Het
Myh11 C A 16: 14,224,059 (GRCm38) R700L possibly damaging Het
Myo16 A G 8: 10,562,240 (GRCm38) D1295G probably damaging Het
Myo5b A G 18: 74,740,488 (GRCm38) M1488V probably benign Het
Naip6 A T 13: 100,299,307 (GRCm38) Y903N probably damaging Het
Nek6 A G 2: 38,550,637 (GRCm38) H19R probably damaging Het
Nktr A C 9: 121,741,126 (GRCm38) T127P probably damaging Het
Noc4l A T 5: 110,649,872 (GRCm38) D335E probably benign Het
Nsd1 A G 13: 55,301,809 (GRCm38) D1993G probably damaging Het
Or1ad1 G A 11: 50,984,856 (GRCm38) D52N probably damaging Het
Or5h22 A T 16: 59,074,256 (GRCm38) F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 (GRCm38) Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 (GRCm38) D127V probably damaging Het
Phrf1 T C 7: 141,259,720 (GRCm38) probably benign Het
Phtf2 T A 5: 20,813,296 (GRCm38) I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 (GRCm38) R1200L probably benign Het
Plod3 G C 5: 136,988,146 (GRCm38) A50P probably benign Het
Prorp G T 12: 55,304,613 (GRCm38) V236F possibly damaging Het
Prss12 A G 3: 123,485,485 (GRCm38) N404D probably benign Het
Ptch2 C G 4: 117,111,206 (GRCm38) A926G probably damaging Het
Ptpra T C 2: 30,443,305 (GRCm38) F6L probably damaging Het
Reck T C 4: 43,942,293 (GRCm38) I853T possibly damaging Het
Reep6 G A 10: 80,330,162 (GRCm38) probably benign Het
Rex2 T A 4: 147,058,697 (GRCm38) S547R probably benign Het
Rgs22 C T 15: 36,107,076 (GRCm38) E55K probably damaging Het
Rtl6 T C 15: 84,557,001 (GRCm38) T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 (GRCm38) P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 (GRCm38) S505G probably benign Het
Scube1 T G 15: 83,608,747 (GRCm38) Q904P probably damaging Het
Sis T C 3: 72,921,184 (GRCm38) Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 (GRCm38) D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 (GRCm38) E200G probably damaging Het
Stard13 C A 5: 151,092,829 (GRCm38) probably null Het
Sybu T C 15: 44,718,943 (GRCm38) K95R probably damaging Het
Trappc9 T A 15: 72,941,947 (GRCm38) D488V probably damaging Het
Txk G A 5: 72,700,663 (GRCm38) P381S probably damaging Het
Ubr2 A T 17: 46,988,722 (GRCm38) M198K probably benign Het
Unc5a A T 13: 55,004,481 (GRCm38) T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 (GRCm38) R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 (GRCm38) probably null Het
Zfp667 T G 7: 6,305,106 (GRCm38) C258G possibly damaging Het
Zfr G A 15: 12,162,233 (GRCm38) R823H probably benign Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52,834,680 (GRCm38) missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52,894,120 (GRCm38) splice site probably benign
IGL01959:Kcnh8 APN 17 52,834,607 (GRCm38) missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52,877,911 (GRCm38) missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52,803,528 (GRCm38) missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52,898,497 (GRCm38) missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52,959,443 (GRCm38) missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52,956,622 (GRCm38) missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52,956,767 (GRCm38) missense probably benign 0.22
Incompetent UTSW 17 52,894,101 (GRCm38) missense probably damaging 1.00
leak UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R0282:Kcnh8 UTSW 17 52,725,851 (GRCm38) missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52,977,620 (GRCm38) splice site probably null
R0496:Kcnh8 UTSW 17 52,725,858 (GRCm38) missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52,894,005 (GRCm38) missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52,978,113 (GRCm38) nonsense probably null
R0891:Kcnh8 UTSW 17 52,905,214 (GRCm38) missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52,725,899 (GRCm38) missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52,803,484 (GRCm38) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52,893,961 (GRCm38) missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52,893,960 (GRCm38) missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52,956,881 (GRCm38) missense probably benign
R1657:Kcnh8 UTSW 17 52,839,125 (GRCm38) missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52,893,968 (GRCm38) missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52,893,933 (GRCm38) missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R1804:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R1929:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R1980:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R1981:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R1982:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2016:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2017:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2132:Kcnh8 UTSW 17 52,893,933 (GRCm38) missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52,893,933 (GRCm38) missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2265:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2266:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2267:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2303:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2309:Kcnh8 UTSW 17 52,978,039 (GRCm38) missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2764:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2857:Kcnh8 UTSW 17 52,977,933 (GRCm38) missense probably benign
R2898:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R2987:Kcnh8 UTSW 17 52,956,735 (GRCm38) missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R3157:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R3158:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4081:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4082:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4087:Kcnh8 UTSW 17 52,803,400 (GRCm38) missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4158:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4213:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4301:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4302:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4383:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4385:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4400:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4490:Kcnh8 UTSW 17 52,961,877 (GRCm38) critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4494:Kcnh8 UTSW 17 52,725,906 (GRCm38) small deletion probably benign
R4611:Kcnh8 UTSW 17 52,602,836 (GRCm38) missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52,725,870 (GRCm38) missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52,905,220 (GRCm38) splice site probably null
R4927:Kcnh8 UTSW 17 52,877,981 (GRCm38) missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52,877,967 (GRCm38) missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52,893,930 (GRCm38) missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52,898,458 (GRCm38) missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52,905,015 (GRCm38) missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52,725,995 (GRCm38) missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52,977,816 (GRCm38) missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52,725,980 (GRCm38) missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52,978,122 (GRCm38) missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52,956,776 (GRCm38) missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52,803,336 (GRCm38) missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52,877,943 (GRCm38) nonsense probably null
R6994:Kcnh8 UTSW 17 52,977,695 (GRCm38) missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52,905,010 (GRCm38) missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52,894,117 (GRCm38) splice site probably null
R7228:Kcnh8 UTSW 17 52,956,716 (GRCm38) missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52,894,101 (GRCm38) missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52,961,843 (GRCm38) missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52,956,715 (GRCm38) missense probably benign
R7952:Kcnh8 UTSW 17 52,959,465 (GRCm38) missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52,978,094 (GRCm38) missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52,956,908 (GRCm38) missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52,905,073 (GRCm38) missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52,978,292 (GRCm38) missense probably benign
R8716:Kcnh8 UTSW 17 52,977,752 (GRCm38) missense probably benign 0.02
R8943:Kcnh8 UTSW 17 52,797,458 (GRCm38) missense probably benign 0.00
R9051:Kcnh8 UTSW 17 52,834,614 (GRCm38) missense probably damaging 1.00
R9211:Kcnh8 UTSW 17 52,839,208 (GRCm38) missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 52,978,140 (GRCm38) missense probably damaging 1.00
R9243:Kcnh8 UTSW 17 52,898,514 (GRCm38) missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 52,839,056 (GRCm38) missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 52,878,061 (GRCm38) missense probably damaging 1.00
R9646:Kcnh8 UTSW 17 52,797,545 (GRCm38) missense probably benign 0.25
RF009:Kcnh8 UTSW 17 52,978,239 (GRCm38) missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52,978,239 (GRCm38) missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52,978,239 (GRCm38) missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52,978,239 (GRCm38) missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52,978,239 (GRCm38) missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52,978,292 (GRCm38) missense probably benign
Z1088:Kcnh8 UTSW 17 52,725,890 (GRCm38) missense probably damaging 1.00
Z1176:Kcnh8 UTSW 17 52,894,061 (GRCm38) missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52,978,093 (GRCm38) missense possibly damaging 0.91
Z1177:Kcnh8 UTSW 17 52,803,471 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGACTGAAGTTGTGTC -3'
(R):5'- CATGTTCCCTGGAGAACTTCTC -3'

Sequencing Primer
(F):5'- GCCTGACTGAAGTTGTGTCTTAAAC -3'
(R):5'- CTTCTCCCAAACACTATAATTGAGTG -3'
Posted On 2015-05-15