Incidental Mutation 'R4080:Unc93b1'
ID316854
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Nameunc-93 homolog B1 (C. elegans)
Synonymsunc-93 homolog B, unc-93 related protein
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3935186-3949340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3941959 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 231 (R231Q)
Ref Sequence ENSEMBL: ENSMUSP00000128751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161415
Predicted Effect probably damaging
Transcript: ENSMUST00000162708
AA Change: R231Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: R231Q

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165711
AA Change: R231Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: R231Q

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4479:Unc93b1 UTSW 19 3935236 missense probably benign 0.16
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5056:Unc93b1 UTSW 19 3942762 missense possibly damaging 0.45
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R5892:Unc93b1 UTSW 19 3943632 missense probably damaging 1.00
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R6962:Unc93b1 UTSW 19 3936303 missense possibly damaging 0.57
R7143:Unc93b1 UTSW 19 3935204 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGGTTTCCCCTGTGAAGCTG -3'
(R):5'- GAACTTCCTCCTGAGCACTGTG -3'

Sequencing Primer
(F):5'- TTCCCCTGTGAAGCTGGCTAG -3'
(R):5'- AGAGGTCTCTCTCCATCACTAGAGG -3'
Posted On2015-05-15