Mutagenetix > Incidental Mutation

Incidental Mutation 'R4081:Tbx15'

316867

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

040977-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R4081 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99313054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 48 (D48G)

Ref Sequence

ENSEMBL: ENSMUSP00000143417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: D154G

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: D154G

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756
AA Change: D48G

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868
AA Change: D48G

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151606
AA Change: D48G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868
AA Change: D48G

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Meta Mutation Damage Score

0.8387

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adad1	A	G	3: 37,064,363		probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Ccnf	T	C	17: 24,223,898	*778W	probably null	Het
Cd53	T	C	3: 106,762,145	H179R	probably benign	Het
Cit	G	T	5: 115,948,050	R891L	probably damaging	Het
Clec4b1	T	C	6: 123,069,774		probably null	Het
Cntrl	C	A	2: 35,161,926		probably benign	Het
Cntrl	A	G	2: 35,175,125	D2148G	probably damaging	Het
Cpa5	T	C	6: 30,631,229	S381P	probably benign	Het
Crybg1	A	T	10: 43,975,039	V1612D	probably damaging	Het
Cwc25	G	T	11: 97,753,918	Q205K	probably benign	Het
Cyp2d11	A	T	15: 82,391,801	I193N	possibly damaging	Het
Gdi2	T	A	13: 3,548,866	C17S	probably benign	Het
Gm5436	T	A	12: 84,258,715		noncoding transcript	Het
Ifit1bl1	T	C	19: 34,594,640	Y139C	possibly damaging	Het
Insr	A	T	8: 3,211,391	M321K	probably benign	Het
Ippk	T	A	13: 49,446,376	L237Q	probably damaging	Het
Itpr1	T	A	6: 108,391,835	I149N	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrp2	T	A	2: 69,513,273	H914L	probably damaging	Het
Myd88	G	T	9: 119,339,987		probably benign	Het
Myh2	T	C	11: 67,190,430	S1291P	probably benign	Het
Mylk3	G	A	8: 85,328,682	L549F	probably damaging	Het
Otog	T	C	7: 46,288,299	S1811P	possibly damaging	Het
Phrf1	T	C	7: 141,259,057		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ptprh	T	A	7: 4,580,988	T202S	probably damaging	Het
Ptprr	A	T	10: 116,236,710	K329N	probably benign	Het
Rgl3	T	A	9: 21,987,675	H156L	possibly damaging	Het
Sema6b	A	G	17: 56,128,307	V312A	probably damaging	Het
Sez6l	T	C	5: 112,461,166	I606V	probably benign	Het
Slco1a1	T	C	6: 141,935,962	E148G	probably damaging	Het
Snph	T	C	2: 151,593,802	D402G	probably damaging	Het
Sohlh1	A	G	2: 25,845,722	V135A	probably benign	Het
Sox14	T	C	9: 99,875,224	E154G	possibly damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Szt2	A	G	4: 118,373,567		probably benign	Het
Tab2	G	A	10: 7,919,831	P296S	probably damaging	Het
Tex10	T	C	4: 48,468,873	S101G	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vmn1r66	A	G	7: 10,274,806	I100T	probably damaging	Het
Vmn2r106	A	T	17: 20,267,556	Y860*	probably null	Het
Vwa3b	C	T	1: 37,035,824	T24I	probably damaging	Het
Zfp541	G	A	7: 16,072,135	S65N	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCAGCAATTCGGGTCTCC -3'
(R):5'- TGGGATCACAGACCATTGGTG -3'

Sequencing Primer
(F):5'- GGGTCTCCATCACAGTTTACAGTG -3'
(R):5'- GGATCACAGACCATTGGTGTATCC -3'

Posted On

2015-05-15