Incidental Mutation 'R4081:Cit'
ID 316874
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Name citron
Synonyms CRIK-SK, C030025P15Rik, citron kinase, Cit-k, citron-N
MMRRC Submission 040977-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R4081 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 115983337-116147006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 116086109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 891 (R891L)
Ref Sequence ENSEMBL: ENSMUSP00000099620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051704
AA Change: R891L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: R891L

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102560
AA Change: R891L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: R891L

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112008
AA Change: R849L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: R849L

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Predicted Effect probably damaging
Transcript: ENSMUST00000141101
AA Change: R849L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: R849L

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,497 (GRCm39) D324E possibly damaging Het
Adad1 A G 3: 37,118,512 (GRCm39) probably null Het
Aim2 T C 1: 173,287,417 (GRCm39) probably null Het
Arhgef1 G T 7: 24,625,271 (GRCm39) D850Y probably damaging Het
Ccnf T C 17: 24,442,872 (GRCm39) *778W probably null Het
Cd53 T C 3: 106,669,461 (GRCm39) H179R probably benign Het
Clec4b1 T C 6: 123,046,733 (GRCm39) probably null Het
Cntrl C A 2: 35,051,938 (GRCm39) probably benign Het
Cntrl A G 2: 35,065,137 (GRCm39) D2148G probably damaging Het
Cpa5 T C 6: 30,631,228 (GRCm39) S381P probably benign Het
Crybg1 A T 10: 43,851,035 (GRCm39) V1612D probably damaging Het
Cwc25 G T 11: 97,644,744 (GRCm39) Q205K probably benign Het
Cyp2d11 A T 15: 82,276,002 (GRCm39) I193N possibly damaging Het
Gdi2 T A 13: 3,598,866 (GRCm39) C17S probably benign Het
Gm5436 T A 12: 84,305,489 (GRCm39) noncoding transcript Het
Ifit1bl1 T C 19: 34,572,040 (GRCm39) Y139C possibly damaging Het
Insr A T 8: 3,261,391 (GRCm39) M321K probably benign Het
Ippk T A 13: 49,599,852 (GRCm39) L237Q probably damaging Het
Itpr1 T A 6: 108,368,796 (GRCm39) I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrp2 T A 2: 69,343,617 (GRCm39) H914L probably damaging Het
Myd88 G T 9: 119,169,053 (GRCm39) probably benign Het
Myh2 T C 11: 67,081,256 (GRCm39) S1291P probably benign Het
Mylk3 G A 8: 86,055,311 (GRCm39) L549F probably damaging Het
Otog T C 7: 45,937,723 (GRCm39) S1811P possibly damaging Het
Phrf1 T C 7: 140,838,970 (GRCm39) probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prorp G T 12: 55,351,398 (GRCm39) V236F possibly damaging Het
Ptprh T A 7: 4,583,987 (GRCm39) T202S probably damaging Het
Ptprr A T 10: 116,072,615 (GRCm39) K329N probably benign Het
Rgl3 T A 9: 21,898,971 (GRCm39) H156L possibly damaging Het
Sema6b A G 17: 56,435,307 (GRCm39) V312A probably damaging Het
Sez6l T C 5: 112,609,032 (GRCm39) I606V probably benign Het
Slco1a1 T C 6: 141,881,688 (GRCm39) E148G probably damaging Het
Snph T C 2: 151,435,722 (GRCm39) D402G probably damaging Het
Sohlh1 A G 2: 25,735,734 (GRCm39) V135A probably benign Het
Sox14 T C 9: 99,757,277 (GRCm39) E154G possibly damaging Het
Spta1 A G 1: 174,041,632 (GRCm39) D1334G probably benign Het
Stard13 C A 5: 151,016,294 (GRCm39) probably null Het
Szt2 A G 4: 118,230,764 (GRCm39) probably benign Het
Tab2 G A 10: 7,795,595 (GRCm39) P296S probably damaging Het
Tbx15 A G 3: 99,220,370 (GRCm39) D48G possibly damaging Het
Tex10 T C 4: 48,468,873 (GRCm39) S101G probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vmn1r66 A G 7: 10,008,733 (GRCm39) I100T probably damaging Het
Vmn2r106 A T 17: 20,487,818 (GRCm39) Y860* probably null Het
Vwa3b C T 1: 37,074,905 (GRCm39) T24I probably damaging Het
Zfp541 G A 7: 15,806,060 (GRCm39) S65N probably benign Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115,984,524 (GRCm39) missense probably damaging 0.99
IGL00482:Cit APN 5 116,076,814 (GRCm39) missense probably damaging 0.97
IGL01317:Cit APN 5 116,046,775 (GRCm39) missense probably benign 0.03
IGL01335:Cit APN 5 116,046,889 (GRCm39) splice site probably benign
IGL01415:Cit APN 5 116,079,962 (GRCm39) missense possibly damaging 0.78
IGL01447:Cit APN 5 116,011,902 (GRCm39) splice site probably benign
IGL01537:Cit APN 5 116,071,913 (GRCm39) missense probably benign 0.00
IGL01621:Cit APN 5 116,130,662 (GRCm39) splice site probably benign
IGL02010:Cit APN 5 116,014,006 (GRCm39) missense probably damaging 1.00
IGL02538:Cit APN 5 116,125,048 (GRCm39) nonsense probably null
IGL02607:Cit APN 5 115,997,268 (GRCm39) missense probably benign
IGL02720:Cit APN 5 116,133,511 (GRCm39) missense probably benign 0.26
IGL02725:Cit APN 5 116,123,532 (GRCm39) missense probably benign 0.02
IGL02967:Cit APN 5 116,083,896 (GRCm39) missense probably benign 0.11
IGL02973:Cit APN 5 116,144,058 (GRCm39) missense possibly damaging 0.73
IGL03383:Cit APN 5 116,011,904 (GRCm39) splice site probably benign
PIT4514001:Cit UTSW 5 116,135,913 (GRCm39) critical splice donor site probably null
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0226:Cit UTSW 5 116,122,899 (GRCm39) missense probably damaging 0.99
R0320:Cit UTSW 5 116,117,504 (GRCm39) missense possibly damaging 0.87
R0401:Cit UTSW 5 116,123,538 (GRCm39) missense probably benign 0.06
R0480:Cit UTSW 5 116,071,452 (GRCm39) splice site probably benign
R0609:Cit UTSW 5 116,012,002 (GRCm39) missense probably damaging 0.98
R0737:Cit UTSW 5 116,084,978 (GRCm39) missense probably damaging 1.00
R1238:Cit UTSW 5 115,989,280 (GRCm39) missense probably benign 0.30
R1503:Cit UTSW 5 116,011,959 (GRCm39) missense possibly damaging 0.94
R1551:Cit UTSW 5 116,083,901 (GRCm39) missense probably benign 0.00
R1602:Cit UTSW 5 116,135,789 (GRCm39) missense probably damaging 1.00
R1720:Cit UTSW 5 116,105,956 (GRCm39) missense probably damaging 0.98
R1854:Cit UTSW 5 116,011,960 (GRCm39) missense probably damaging 1.00
R1886:Cit UTSW 5 116,071,545 (GRCm39) missense probably damaging 1.00
R2024:Cit UTSW 5 116,143,899 (GRCm39) missense probably damaging 0.97
R2024:Cit UTSW 5 116,085,983 (GRCm39) missense probably damaging 0.97
R2048:Cit UTSW 5 116,024,872 (GRCm39) splice site probably null
R2128:Cit UTSW 5 116,123,566 (GRCm39) missense possibly damaging 0.63
R2192:Cit UTSW 5 116,106,068 (GRCm39) missense probably benign 0.00
R2244:Cit UTSW 5 116,064,564 (GRCm39) missense probably damaging 1.00
R2518:Cit UTSW 5 116,125,105 (GRCm39) missense probably damaging 0.99
R2679:Cit UTSW 5 116,107,174 (GRCm39) missense probably benign 0.00
R2898:Cit UTSW 5 116,012,037 (GRCm39) splice site probably null
R2908:Cit UTSW 5 116,119,735 (GRCm39) missense probably benign 0.00
R3079:Cit UTSW 5 116,063,545 (GRCm39) missense probably damaging 0.97
R3779:Cit UTSW 5 115,997,400 (GRCm39) missense probably benign 0.01
R4494:Cit UTSW 5 116,012,043 (GRCm39) missense probably damaging 1.00
R4610:Cit UTSW 5 116,132,146 (GRCm39) missense probably benign 0.01
R4757:Cit UTSW 5 116,135,608 (GRCm39) missense probably damaging 1.00
R4788:Cit UTSW 5 116,071,565 (GRCm39) missense probably damaging 1.00
R4816:Cit UTSW 5 116,046,750 (GRCm39) missense probably damaging 1.00
R4890:Cit UTSW 5 116,126,182 (GRCm39) intron probably benign
R4899:Cit UTSW 5 116,001,087 (GRCm39) missense possibly damaging 0.60
R4928:Cit UTSW 5 116,123,856 (GRCm39) missense probably benign 0.00
R5073:Cit UTSW 5 116,084,902 (GRCm39) missense probably benign 0.24
R5151:Cit UTSW 5 116,117,894 (GRCm39) missense probably damaging 1.00
R5154:Cit UTSW 5 116,126,464 (GRCm39) missense probably damaging 1.00
R5222:Cit UTSW 5 116,090,602 (GRCm39) missense probably benign 0.03
R5814:Cit UTSW 5 116,117,478 (GRCm39) missense probably damaging 1.00
R5935:Cit UTSW 5 116,063,598 (GRCm39) intron probably benign
R5946:Cit UTSW 5 116,135,593 (GRCm39) missense probably damaging 1.00
R6051:Cit UTSW 5 115,984,464 (GRCm39) missense probably benign
R6289:Cit UTSW 5 116,144,385 (GRCm39) makesense probably null
R6298:Cit UTSW 5 116,086,124 (GRCm39) missense probably damaging 1.00
R6362:Cit UTSW 5 116,024,735 (GRCm39) missense probably benign 0.01
R6545:Cit UTSW 5 115,984,493 (GRCm39) missense probably null 0.00
R6761:Cit UTSW 5 116,046,734 (GRCm39) missense probably damaging 1.00
R6798:Cit UTSW 5 116,064,585 (GRCm39) missense possibly damaging 0.56
R6814:Cit UTSW 5 116,023,022 (GRCm39) missense probably damaging 1.00
R6825:Cit UTSW 5 116,119,833 (GRCm39) missense probably damaging 0.99
R6845:Cit UTSW 5 116,122,947 (GRCm39) missense probably damaging 1.00
R6983:Cit UTSW 5 116,132,150 (GRCm39) missense probably damaging 1.00
R7164:Cit UTSW 5 116,123,846 (GRCm39) missense possibly damaging 0.94
R7359:Cit UTSW 5 116,064,633 (GRCm39) missense probably damaging 1.00
R7597:Cit UTSW 5 116,024,740 (GRCm39) nonsense probably null
R7729:Cit UTSW 5 116,122,881 (GRCm39) missense possibly damaging 0.87
R7763:Cit UTSW 5 116,125,060 (GRCm39) missense probably benign 0.01
R7786:Cit UTSW 5 116,001,077 (GRCm39) missense probably benign 0.00
R7799:Cit UTSW 5 116,001,027 (GRCm39) missense probably benign 0.00
R8060:Cit UTSW 5 116,046,786 (GRCm39) missense probably benign 0.00
R8068:Cit UTSW 5 116,120,294 (GRCm39) missense probably benign 0.03
R8068:Cit UTSW 5 116,090,525 (GRCm39) missense probably damaging 1.00
R8122:Cit UTSW 5 116,107,069 (GRCm39) missense probably damaging 1.00
R8177:Cit UTSW 5 116,126,218 (GRCm39) missense probably benign 0.18
R8178:Cit UTSW 5 116,107,131 (GRCm39) missense probably damaging 1.00
R8265:Cit UTSW 5 116,126,236 (GRCm39) missense probably damaging 1.00
R8359:Cit UTSW 5 116,122,603 (GRCm39) splice site probably null
R8397:Cit UTSW 5 116,024,856 (GRCm39) missense probably benign
R8489:Cit UTSW 5 116,083,962 (GRCm39) critical splice donor site probably null
R8784:Cit UTSW 5 115,984,442 (GRCm39) nonsense probably null
R8798:Cit UTSW 5 116,107,102 (GRCm39) missense probably damaging 0.99
R8882:Cit UTSW 5 116,001,089 (GRCm39) missense probably benign 0.04
R8984:Cit UTSW 5 116,064,534 (GRCm39) missense possibly damaging 0.86
R9091:Cit UTSW 5 115,984,161 (GRCm39) intron probably benign
R9127:Cit UTSW 5 116,074,896 (GRCm39) nonsense probably null
R9204:Cit UTSW 5 116,126,498 (GRCm39) missense probably damaging 0.99
R9212:Cit UTSW 5 116,013,952 (GRCm39) missense possibly damaging 0.75
R9279:Cit UTSW 5 116,065,970 (GRCm39) missense probably damaging 1.00
R9288:Cit UTSW 5 116,123,512 (GRCm39) missense probably damaging 1.00
R9377:Cit UTSW 5 116,084,914 (GRCm39) missense probably benign 0.04
R9520:Cit UTSW 5 116,079,954 (GRCm39) nonsense probably null
Z1088:Cit UTSW 5 116,123,592 (GRCm39) missense possibly damaging 0.62
Z1176:Cit UTSW 5 116,124,662 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTTGGAGTGCCCACTG -3'
(R):5'- CATGGCCCAGACTCAATGCTTAG -3'

Sequencing Primer
(F):5'- GCAAGTTGTACCTTCTCACTCTG -3'
(R):5'- TTAGTCACCATGTGCAAGGC -3'
Posted On 2015-05-15