Mutagenetix > Incidental Mutation

Incidental Mutation 'R4081:Cit'

316874

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

040977-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R4081 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 115948050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 891 (R891L)

Ref Sequence

ENSEMBL: ENSMUSP00000099620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051704
AA Change: R891L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: R891L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102560
AA Change: R891L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: R891L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: R849L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: R849L

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122877

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136780

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139881

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: R849L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: R849L

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147479

Meta Mutation Damage Score

0.1094

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adad1	A	G	3: 37,064,363		probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Ccnf	T	C	17: 24,223,898	*778W	probably null	Het
Cd53	T	C	3: 106,762,145	H179R	probably benign	Het
Clec4b1	T	C	6: 123,069,774		probably null	Het
Cntrl	C	A	2: 35,161,926		probably benign	Het
Cntrl	A	G	2: 35,175,125	D2148G	probably damaging	Het
Cpa5	T	C	6: 30,631,229	S381P	probably benign	Het
Crybg1	A	T	10: 43,975,039	V1612D	probably damaging	Het
Cwc25	G	T	11: 97,753,918	Q205K	probably benign	Het
Cyp2d11	A	T	15: 82,391,801	I193N	possibly damaging	Het
Gdi2	T	A	13: 3,548,866	C17S	probably benign	Het
Gm5436	T	A	12: 84,258,715		noncoding transcript	Het
Ifit1bl1	T	C	19: 34,594,640	Y139C	possibly damaging	Het
Insr	A	T	8: 3,211,391	M321K	probably benign	Het
Ippk	T	A	13: 49,446,376	L237Q	probably damaging	Het
Itpr1	T	A	6: 108,391,835	I149N	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrp2	T	A	2: 69,513,273	H914L	probably damaging	Het
Myd88	G	T	9: 119,339,987		probably benign	Het
Myh2	T	C	11: 67,190,430	S1291P	probably benign	Het
Mylk3	G	A	8: 85,328,682	L549F	probably damaging	Het
Otog	T	C	7: 46,288,299	S1811P	possibly damaging	Het
Phrf1	T	C	7: 141,259,057		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ptprh	T	A	7: 4,580,988	T202S	probably damaging	Het
Ptprr	A	T	10: 116,236,710	K329N	probably benign	Het
Rgl3	T	A	9: 21,987,675	H156L	possibly damaging	Het
Sema6b	A	G	17: 56,128,307	V312A	probably damaging	Het
Sez6l	T	C	5: 112,461,166	I606V	probably benign	Het
Slco1a1	T	C	6: 141,935,962	E148G	probably damaging	Het
Snph	T	C	2: 151,593,802	D402G	probably damaging	Het
Sohlh1	A	G	2: 25,845,722	V135A	probably benign	Het
Sox14	T	C	9: 99,875,224	E154G	possibly damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Szt2	A	G	4: 118,373,567		probably benign	Het
Tab2	G	A	10: 7,919,831	P296S	probably damaging	Het
Tbx15	A	G	3: 99,313,054	D48G	possibly damaging	Het
Tex10	T	C	4: 48,468,873	S101G	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vmn1r66	A	G	7: 10,274,806	I100T	probably damaging	Het
Vmn2r106	A	T	17: 20,267,556	Y860*	probably null	Het
Vwa3b	C	T	1: 37,035,824	T24I	probably damaging	Het
Zfp541	G	A	7: 16,072,135	S65N	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATCTTGGAGTGCCCACTG -3'
(R):5'- CATGGCCCAGACTCAATGCTTAG -3'

Sequencing Primer
(F):5'- GCAAGTTGTACCTTCTCACTCTG -3'
(R):5'- TTAGTCACCATGTGCAAGGC -3'

Posted On

2015-05-15