Mutagenetix > Incidental Mutation

Incidental Mutation 'R4081:Arhgef1'

316884

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

040977-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R4081 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 24925846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 850 (D850Y)

Ref Sequence

ENSEMBL: ENSMUSP00000146314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508] [ENSMUST00000206705]

AlphaFold

Q61210

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047873
AA Change: D851Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: D851Y

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098683
AA Change: D910Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: D910Y

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117419
AA Change: D851Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: D851Y

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117796
AA Change: D907Y

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: D907Y

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126484

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129928

Predicted Effect

probably benign
Transcript: ENSMUST00000132751

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145783

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

probably damaging
Transcript: ENSMUST00000206508
AA Change: D850Y

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000206705

Meta Mutation Damage Score

0.1091

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adad1	A	G	3: 37,064,363		probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Ccnf	T	C	17: 24,223,898	*778W	probably null	Het
Cd53	T	C	3: 106,762,145	H179R	probably benign	Het
Cit	G	T	5: 115,948,050	R891L	probably damaging	Het
Clec4b1	T	C	6: 123,069,774		probably null	Het
Cntrl	C	A	2: 35,161,926		probably benign	Het
Cntrl	A	G	2: 35,175,125	D2148G	probably damaging	Het
Cpa5	T	C	6: 30,631,229	S381P	probably benign	Het
Crybg1	A	T	10: 43,975,039	V1612D	probably damaging	Het
Cwc25	G	T	11: 97,753,918	Q205K	probably benign	Het
Cyp2d11	A	T	15: 82,391,801	I193N	possibly damaging	Het
Gdi2	T	A	13: 3,548,866	C17S	probably benign	Het
Gm5436	T	A	12: 84,258,715		noncoding transcript	Het
Ifit1bl1	T	C	19: 34,594,640	Y139C	possibly damaging	Het
Insr	A	T	8: 3,211,391	M321K	probably benign	Het
Ippk	T	A	13: 49,446,376	L237Q	probably damaging	Het
Itpr1	T	A	6: 108,391,835	I149N	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrp2	T	A	2: 69,513,273	H914L	probably damaging	Het
Myd88	G	T	9: 119,339,987		probably benign	Het
Myh2	T	C	11: 67,190,430	S1291P	probably benign	Het
Mylk3	G	A	8: 85,328,682	L549F	probably damaging	Het
Otog	T	C	7: 46,288,299	S1811P	possibly damaging	Het
Phrf1	T	C	7: 141,259,057		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ptprh	T	A	7: 4,580,988	T202S	probably damaging	Het
Ptprr	A	T	10: 116,236,710	K329N	probably benign	Het
Rgl3	T	A	9: 21,987,675	H156L	possibly damaging	Het
Sema6b	A	G	17: 56,128,307	V312A	probably damaging	Het
Sez6l	T	C	5: 112,461,166	I606V	probably benign	Het
Slco1a1	T	C	6: 141,935,962	E148G	probably damaging	Het
Snph	T	C	2: 151,593,802	D402G	probably damaging	Het
Sohlh1	A	G	2: 25,845,722	V135A	probably benign	Het
Sox14	T	C	9: 99,875,224	E154G	possibly damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Szt2	A	G	4: 118,373,567		probably benign	Het
Tab2	G	A	10: 7,919,831	P296S	probably damaging	Het
Tbx15	A	G	3: 99,313,054	D48G	possibly damaging	Het
Tex10	T	C	4: 48,468,873	S101G	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vmn1r66	A	G	7: 10,274,806	I100T	probably damaging	Het
Vmn2r106	A	T	17: 20,267,556	Y860*	probably null	Het
Vwa3b	C	T	1: 37,035,824	T24I	probably damaging	Het
Zfp541	G	A	7: 16,072,135	S65N	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5255:Arhgef1	UTSW	7	24925022	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5295:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6150:Arhgef1	UTSW	7	24919357	splice site	probably null
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8029:Arhgef1	UTSW	7	24919738	missense	probably damaging	1.00
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null
R8168:Arhgef1	UTSW	7	24925406	missense	probably benign	0.06
R8964:Arhgef1	UTSW	7	24923037	missense	probably damaging	1.00
R9114:Arhgef1	UTSW	7	24907879	missense	probably damaging	1.00
R9553:Arhgef1	UTSW	7	24919690	missense	probably damaging	1.00
R9676:Arhgef1	UTSW	7	24926076	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCGCTAAGTTCAGCTTCTCC -3'
(R):5'- TTAGGCGACAAAATTCCTCTTCC -3'

Sequencing Primer
(F):5'- GCTTCTCCAGCCCCAGG -3'
(R):5'- TTCCAACTCCTGAAGGGGATC -3'

Posted On

2015-05-15