Incidental Mutation 'R4081:Arhgef1'
ID 316884
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene Name Rho guanine nucleotide exchange factor 1
Synonyms Lbcl2, Lsc
MMRRC Submission 040977-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.461) question?
Stock # R4081 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24602337-24626019 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24625271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 850 (D850Y)
Ref Sequence ENSEMBL: ENSMUSP00000146314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000206508] [ENSMUST00000205295] [ENSMUST00000206705]
AlphaFold Q61210
Predicted Effect possibly damaging
Transcript: ENSMUST00000047873
AA Change: D851Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: D851Y

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098683
AA Change: D910Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: D910Y

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117419
AA Change: D851Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: D851Y

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117796
AA Change: D907Y

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: D907Y

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129928
Predicted Effect probably benign
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably damaging
Transcript: ENSMUST00000206508
AA Change: D850Y

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably benign
Transcript: ENSMUST00000206705
Meta Mutation Damage Score 0.1091 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,497 (GRCm39) D324E possibly damaging Het
Adad1 A G 3: 37,118,512 (GRCm39) probably null Het
Aim2 T C 1: 173,287,417 (GRCm39) probably null Het
Ccnf T C 17: 24,442,872 (GRCm39) *778W probably null Het
Cd53 T C 3: 106,669,461 (GRCm39) H179R probably benign Het
Cit G T 5: 116,086,109 (GRCm39) R891L probably damaging Het
Clec4b1 T C 6: 123,046,733 (GRCm39) probably null Het
Cntrl C A 2: 35,051,938 (GRCm39) probably benign Het
Cntrl A G 2: 35,065,137 (GRCm39) D2148G probably damaging Het
Cpa5 T C 6: 30,631,228 (GRCm39) S381P probably benign Het
Crybg1 A T 10: 43,851,035 (GRCm39) V1612D probably damaging Het
Cwc25 G T 11: 97,644,744 (GRCm39) Q205K probably benign Het
Cyp2d11 A T 15: 82,276,002 (GRCm39) I193N possibly damaging Het
Gdi2 T A 13: 3,598,866 (GRCm39) C17S probably benign Het
Gm5436 T A 12: 84,305,489 (GRCm39) noncoding transcript Het
Ifit1bl1 T C 19: 34,572,040 (GRCm39) Y139C possibly damaging Het
Insr A T 8: 3,261,391 (GRCm39) M321K probably benign Het
Ippk T A 13: 49,599,852 (GRCm39) L237Q probably damaging Het
Itpr1 T A 6: 108,368,796 (GRCm39) I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrp2 T A 2: 69,343,617 (GRCm39) H914L probably damaging Het
Myd88 G T 9: 119,169,053 (GRCm39) probably benign Het
Myh2 T C 11: 67,081,256 (GRCm39) S1291P probably benign Het
Mylk3 G A 8: 86,055,311 (GRCm39) L549F probably damaging Het
Otog T C 7: 45,937,723 (GRCm39) S1811P possibly damaging Het
Phrf1 T C 7: 140,838,970 (GRCm39) probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prorp G T 12: 55,351,398 (GRCm39) V236F possibly damaging Het
Ptprh T A 7: 4,583,987 (GRCm39) T202S probably damaging Het
Ptprr A T 10: 116,072,615 (GRCm39) K329N probably benign Het
Rgl3 T A 9: 21,898,971 (GRCm39) H156L possibly damaging Het
Sema6b A G 17: 56,435,307 (GRCm39) V312A probably damaging Het
Sez6l T C 5: 112,609,032 (GRCm39) I606V probably benign Het
Slco1a1 T C 6: 141,881,688 (GRCm39) E148G probably damaging Het
Snph T C 2: 151,435,722 (GRCm39) D402G probably damaging Het
Sohlh1 A G 2: 25,735,734 (GRCm39) V135A probably benign Het
Sox14 T C 9: 99,757,277 (GRCm39) E154G possibly damaging Het
Spta1 A G 1: 174,041,632 (GRCm39) D1334G probably benign Het
Stard13 C A 5: 151,016,294 (GRCm39) probably null Het
Szt2 A G 4: 118,230,764 (GRCm39) probably benign Het
Tab2 G A 10: 7,795,595 (GRCm39) P296S probably damaging Het
Tbx15 A G 3: 99,220,370 (GRCm39) D48G possibly damaging Het
Tex10 T C 4: 48,468,873 (GRCm39) S101G probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vmn1r66 A G 7: 10,008,733 (GRCm39) I100T probably damaging Het
Vmn2r106 A T 17: 20,487,818 (GRCm39) Y860* probably null Het
Vwa3b C T 1: 37,074,905 (GRCm39) T24I probably damaging Het
Zfp541 G A 7: 15,806,060 (GRCm39) S65N probably benign Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24,607,784 (GRCm39) missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24,612,118 (GRCm39) missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24,625,376 (GRCm39) unclassified probably benign
IGL01479:Arhgef1 APN 7 24,612,028 (GRCm39) missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24,621,307 (GRCm39) missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24,625,208 (GRCm39) critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24,622,796 (GRCm39) missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24,611,977 (GRCm39) splice site probably benign
IGL02202:Arhgef1 APN 7 24,612,854 (GRCm39) nonsense probably null
IGL02324:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24,623,157 (GRCm39) missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24,622,276 (GRCm39) missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24,616,268 (GRCm39) missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24,612,030 (GRCm39) nonsense probably null
R0277:Arhgef1 UTSW 7 24,623,224 (GRCm39) unclassified probably benign
R0336:Arhgef1 UTSW 7 24,621,382 (GRCm39) missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24,618,785 (GRCm39) intron probably benign
R0668:Arhgef1 UTSW 7 24,607,345 (GRCm39) missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24,619,129 (GRCm39) missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24,624,423 (GRCm39) missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24,613,057 (GRCm39) missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24,607,176 (GRCm39) missense unknown
R3855:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24,611,996 (GRCm39) missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24,618,001 (GRCm39) intron probably benign
R4914:Arhgef1 UTSW 7 24,623,264 (GRCm39) missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24,624,447 (GRCm39) missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24,611,732 (GRCm39) splice site probably null
R5604:Arhgef1 UTSW 7 24,612,210 (GRCm39) missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24,618,782 (GRCm39) splice site probably null
R6151:Arhgef1 UTSW 7 24,617,367 (GRCm39) missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24,619,205 (GRCm39) splice site probably null
R6943:Arhgef1 UTSW 7 24,623,156 (GRCm39) missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24,616,348 (GRCm39) missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24,615,461 (GRCm39) missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24,612,003 (GRCm39) missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24,618,641 (GRCm39) missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24,619,163 (GRCm39) missense probably damaging 1.00
R8132:Arhgef1 UTSW 7 24,619,174 (GRCm39) nonsense probably null
R8132:Arhgef1 UTSW 7 24,607,087 (GRCm39) intron probably benign
R8168:Arhgef1 UTSW 7 24,624,831 (GRCm39) missense probably benign 0.06
R8964:Arhgef1 UTSW 7 24,622,462 (GRCm39) missense probably damaging 1.00
R9114:Arhgef1 UTSW 7 24,607,304 (GRCm39) missense probably damaging 1.00
R9553:Arhgef1 UTSW 7 24,619,115 (GRCm39) missense probably damaging 1.00
R9676:Arhgef1 UTSW 7 24,625,501 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGCTAAGTTCAGCTTCTCC -3'
(R):5'- TTAGGCGACAAAATTCCTCTTCC -3'

Sequencing Primer
(F):5'- GCTTCTCCAGCCCCAGG -3'
(R):5'- TTCCAACTCCTGAAGGGGATC -3'
Posted On 2015-05-15