Incidental Mutation 'R4081:Insr'
ID 316888
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Name insulin receptor
Synonyms 4932439J01Rik, D630014A15Rik, IR, IR-B, IR-A, CD220
MMRRC Submission 040977-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.880) question?
Stock # R4081 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3200922-3329649 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3261391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 321 (M321K)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
AlphaFold P15208
PDB Structure 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000091291
AA Change: M321K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: M321K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139504
Meta Mutation Damage Score 0.2777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,497 (GRCm39) D324E possibly damaging Het
Adad1 A G 3: 37,118,512 (GRCm39) probably null Het
Aim2 T C 1: 173,287,417 (GRCm39) probably null Het
Arhgef1 G T 7: 24,625,271 (GRCm39) D850Y probably damaging Het
Ccnf T C 17: 24,442,872 (GRCm39) *778W probably null Het
Cd53 T C 3: 106,669,461 (GRCm39) H179R probably benign Het
Cit G T 5: 116,086,109 (GRCm39) R891L probably damaging Het
Clec4b1 T C 6: 123,046,733 (GRCm39) probably null Het
Cntrl C A 2: 35,051,938 (GRCm39) probably benign Het
Cntrl A G 2: 35,065,137 (GRCm39) D2148G probably damaging Het
Cpa5 T C 6: 30,631,228 (GRCm39) S381P probably benign Het
Crybg1 A T 10: 43,851,035 (GRCm39) V1612D probably damaging Het
Cwc25 G T 11: 97,644,744 (GRCm39) Q205K probably benign Het
Cyp2d11 A T 15: 82,276,002 (GRCm39) I193N possibly damaging Het
Gdi2 T A 13: 3,598,866 (GRCm39) C17S probably benign Het
Gm5436 T A 12: 84,305,489 (GRCm39) noncoding transcript Het
Ifit1bl1 T C 19: 34,572,040 (GRCm39) Y139C possibly damaging Het
Ippk T A 13: 49,599,852 (GRCm39) L237Q probably damaging Het
Itpr1 T A 6: 108,368,796 (GRCm39) I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrp2 T A 2: 69,343,617 (GRCm39) H914L probably damaging Het
Myd88 G T 9: 119,169,053 (GRCm39) probably benign Het
Myh2 T C 11: 67,081,256 (GRCm39) S1291P probably benign Het
Mylk3 G A 8: 86,055,311 (GRCm39) L549F probably damaging Het
Otog T C 7: 45,937,723 (GRCm39) S1811P possibly damaging Het
Phrf1 T C 7: 140,838,970 (GRCm39) probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prorp G T 12: 55,351,398 (GRCm39) V236F possibly damaging Het
Ptprh T A 7: 4,583,987 (GRCm39) T202S probably damaging Het
Ptprr A T 10: 116,072,615 (GRCm39) K329N probably benign Het
Rgl3 T A 9: 21,898,971 (GRCm39) H156L possibly damaging Het
Sema6b A G 17: 56,435,307 (GRCm39) V312A probably damaging Het
Sez6l T C 5: 112,609,032 (GRCm39) I606V probably benign Het
Slco1a1 T C 6: 141,881,688 (GRCm39) E148G probably damaging Het
Snph T C 2: 151,435,722 (GRCm39) D402G probably damaging Het
Sohlh1 A G 2: 25,735,734 (GRCm39) V135A probably benign Het
Sox14 T C 9: 99,757,277 (GRCm39) E154G possibly damaging Het
Spta1 A G 1: 174,041,632 (GRCm39) D1334G probably benign Het
Stard13 C A 5: 151,016,294 (GRCm39) probably null Het
Szt2 A G 4: 118,230,764 (GRCm39) probably benign Het
Tab2 G A 10: 7,795,595 (GRCm39) P296S probably damaging Het
Tbx15 A G 3: 99,220,370 (GRCm39) D48G possibly damaging Het
Tex10 T C 4: 48,468,873 (GRCm39) S101G probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vmn1r66 A G 7: 10,008,733 (GRCm39) I100T probably damaging Het
Vmn2r106 A T 17: 20,487,818 (GRCm39) Y860* probably null Het
Vwa3b C T 1: 37,074,905 (GRCm39) T24I probably damaging Het
Zfp541 G A 7: 15,806,060 (GRCm39) S65N probably benign Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3,308,682 (GRCm39) missense probably damaging 1.00
IGL01986:Insr APN 8 3,208,817 (GRCm39) missense probably damaging 1.00
IGL02135:Insr APN 8 3,308,741 (GRCm39) missense probably damaging 1.00
IGL02203:Insr APN 8 3,205,817 (GRCm39) missense probably benign 0.18
IGL02220:Insr APN 8 3,209,578 (GRCm39) missense probably damaging 1.00
IGL02678:Insr APN 8 3,223,570 (GRCm39) missense probably benign 0.00
IGL02961:Insr APN 8 3,308,785 (GRCm39) missense probably benign 0.08
IGL03099:Insr APN 8 3,308,715 (GRCm39) missense probably damaging 1.00
IGL03125:Insr APN 8 3,234,972 (GRCm39) missense possibly damaging 0.87
IGL03290:Insr APN 8 3,308,574 (GRCm39) missense probably damaging 1.00
gummi_bear UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
jellybelly UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
Patently UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
trolli UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R0047:Insr UTSW 8 3,252,947 (GRCm39) missense probably damaging 0.97
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0480:Insr UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
R0748:Insr UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
R0919:Insr UTSW 8 3,208,769 (GRCm39) missense probably damaging 1.00
R1348:Insr UTSW 8 3,242,635 (GRCm39) missense probably damaging 1.00
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1568:Insr UTSW 8 3,215,576 (GRCm39) missense probably benign
R1768:Insr UTSW 8 3,209,561 (GRCm39) missense probably damaging 1.00
R2093:Insr UTSW 8 3,254,762 (GRCm39) missense probably damaging 1.00
R2111:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2112:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2352:Insr UTSW 8 3,242,593 (GRCm39) missense probably damaging 1.00
R2364:Insr UTSW 8 3,224,820 (GRCm39) missense probably benign
R2842:Insr UTSW 8 3,252,986 (GRCm39) missense probably damaging 1.00
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R4441:Insr UTSW 8 3,244,902 (GRCm39) missense probably benign 0.00
R4672:Insr UTSW 8 3,217,501 (GRCm39) critical splice donor site probably null
R4687:Insr UTSW 8 3,211,709 (GRCm39) missense probably benign 0.42
R4708:Insr UTSW 8 3,261,346 (GRCm39) intron probably benign
R4890:Insr UTSW 8 3,248,234 (GRCm39) missense probably benign 0.16
R4949:Insr UTSW 8 3,235,059 (GRCm39) missense probably benign 0.04
R4996:Insr UTSW 8 3,242,665 (GRCm39) missense probably null 0.98
R5073:Insr UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
R5176:Insr UTSW 8 3,208,742 (GRCm39) missense probably benign 0.03
R5200:Insr UTSW 8 3,248,059 (GRCm39) critical splice donor site probably null
R5323:Insr UTSW 8 3,252,902 (GRCm39) missense probably benign 0.02
R5453:Insr UTSW 8 3,205,694 (GRCm39) missense probably benign 0.06
R5516:Insr UTSW 8 3,205,764 (GRCm39) nonsense probably null
R5704:Insr UTSW 8 3,235,122 (GRCm39) missense possibly damaging 0.52
R5820:Insr UTSW 8 3,205,976 (GRCm39) missense probably damaging 1.00
R5879:Insr UTSW 8 3,248,173 (GRCm39) nonsense probably null
R5894:Insr UTSW 8 3,224,869 (GRCm39) missense possibly damaging 0.88
R5937:Insr UTSW 8 3,224,808 (GRCm39) missense probably benign
R5966:Insr UTSW 8 3,308,697 (GRCm39) missense probably benign 0.04
R6134:Insr UTSW 8 3,242,572 (GRCm39) missense probably damaging 1.00
R6352:Insr UTSW 8 3,223,479 (GRCm39) critical splice donor site probably null
R6423:Insr UTSW 8 3,223,566 (GRCm39) missense probably benign
R6687:Insr UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R6985:Insr UTSW 8 3,211,372 (GRCm39) missense possibly damaging 0.87
R6993:Insr UTSW 8 3,308,752 (GRCm39) missense probably damaging 1.00
R7041:Insr UTSW 8 3,308,418 (GRCm39) missense probably benign
R7109:Insr UTSW 8 3,308,481 (GRCm39) missense probably benign 0.33
R7216:Insr UTSW 8 3,253,034 (GRCm39) missense possibly damaging 0.53
R7287:Insr UTSW 8 3,219,717 (GRCm39) missense probably benign 0.00
R7378:Insr UTSW 8 3,248,231 (GRCm39) missense probably damaging 1.00
R7525:Insr UTSW 8 3,242,642 (GRCm39) missense probably damaging 1.00
R7572:Insr UTSW 8 3,223,602 (GRCm39) missense probably benign 0.11
R7636:Insr UTSW 8 3,308,709 (GRCm39) missense probably damaging 1.00
R7684:Insr UTSW 8 3,219,753 (GRCm39) missense possibly damaging 0.85
R7840:Insr UTSW 8 3,308,415 (GRCm39) missense probably benign 0.04
R8075:Insr UTSW 8 3,205,862 (GRCm39) missense probably benign 0.17
R8161:Insr UTSW 8 3,308,660 (GRCm39) missense probably damaging 1.00
R8220:Insr UTSW 8 3,208,702 (GRCm39) missense probably benign 0.01
R8434:Insr UTSW 8 3,215,514 (GRCm39) splice site probably benign
R8810:Insr UTSW 8 3,219,714 (GRCm39) missense probably benign
R8865:Insr UTSW 8 3,211,358 (GRCm39) missense probably damaging 1.00
R8884:Insr UTSW 8 3,205,679 (GRCm39) missense probably benign
R9134:Insr UTSW 8 3,308,413 (GRCm39) missense probably damaging 1.00
R9359:Insr UTSW 8 3,208,717 (GRCm39) missense probably damaging 1.00
R9407:Insr UTSW 8 3,235,106 (GRCm39) missense probably benign
R9647:Insr UTSW 8 3,205,874 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCCTGTGCAGAGTAGGAGG -3'
(R):5'- CTGTCGCAACTTCTATCTGGATG -3'

Sequencing Primer
(F):5'- CTTCCAAATGCTAGGATCACTGG -3'
(R):5'- CGCAACTTCTATCTGGATGGTCAG -3'
Posted On 2015-05-15