Mutagenetix > Incidental Mutation

Incidental Mutation 'R4081:Insr'

316888

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

040977-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R4081 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3211391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 321 (M321K)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000091291
AA Change: M321K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: M321K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139504

Meta Mutation Damage Score

0.2777

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adad1	A	G	3: 37,064,363		probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Ccnf	T	C	17: 24,223,898	*778W	probably null	Het
Cd53	T	C	3: 106,762,145	H179R	probably benign	Het
Cit	G	T	5: 115,948,050	R891L	probably damaging	Het
Clec4b1	T	C	6: 123,069,774		probably null	Het
Cntrl	C	A	2: 35,161,926		probably benign	Het
Cntrl	A	G	2: 35,175,125	D2148G	probably damaging	Het
Cpa5	T	C	6: 30,631,229	S381P	probably benign	Het
Crybg1	A	T	10: 43,975,039	V1612D	probably damaging	Het
Cwc25	G	T	11: 97,753,918	Q205K	probably benign	Het
Cyp2d11	A	T	15: 82,391,801	I193N	possibly damaging	Het
Gdi2	T	A	13: 3,548,866	C17S	probably benign	Het
Gm5436	T	A	12: 84,258,715		noncoding transcript	Het
Ifit1bl1	T	C	19: 34,594,640	Y139C	possibly damaging	Het
Ippk	T	A	13: 49,446,376	L237Q	probably damaging	Het
Itpr1	T	A	6: 108,391,835	I149N	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrp2	T	A	2: 69,513,273	H914L	probably damaging	Het
Myd88	G	T	9: 119,339,987		probably benign	Het
Myh2	T	C	11: 67,190,430	S1291P	probably benign	Het
Mylk3	G	A	8: 85,328,682	L549F	probably damaging	Het
Otog	T	C	7: 46,288,299	S1811P	possibly damaging	Het
Phrf1	T	C	7: 141,259,057		probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ptprh	T	A	7: 4,580,988	T202S	probably damaging	Het
Ptprr	A	T	10: 116,236,710	K329N	probably benign	Het
Rgl3	T	A	9: 21,987,675	H156L	possibly damaging	Het
Sema6b	A	G	17: 56,128,307	V312A	probably damaging	Het
Sez6l	T	C	5: 112,461,166	I606V	probably benign	Het
Slco1a1	T	C	6: 141,935,962	E148G	probably damaging	Het
Snph	T	C	2: 151,593,802	D402G	probably damaging	Het
Sohlh1	A	G	2: 25,845,722	V135A	probably benign	Het
Sox14	T	C	9: 99,875,224	E154G	possibly damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Szt2	A	G	4: 118,373,567		probably benign	Het
Tab2	G	A	10: 7,919,831	P296S	probably damaging	Het
Tbx15	A	G	3: 99,313,054	D48G	possibly damaging	Het
Tex10	T	C	4: 48,468,873	S101G	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Vmn1r66	A	G	7: 10,274,806	I100T	probably damaging	Het
Vmn2r106	A	T	17: 20,267,556	Y860*	probably null	Het
Vwa3b	C	T	1: 37,035,824	T24I	probably damaging	Het
Zfp541	G	A	7: 16,072,135	S65N	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1568:Insr	UTSW	8	3165576	missense	probably benign
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4687:Insr	UTSW	8	3161709	missense	probably benign	0.42
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5176:Insr	UTSW	8	3158742	missense	probably benign	0.03
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7109:Insr	UTSW	8	3258481	missense	probably benign	0.33
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTCCTGTGCAGAGTAGGAGG -3'
(R):5'- CTGTCGCAACTTCTATCTGGATG -3'

Sequencing Primer
(F):5'- CTTCCAAATGCTAGGATCACTGG -3'
(R):5'- CGCAACTTCTATCTGGATGGTCAG -3'

Posted On

2015-05-15