Incidental Mutation 'R4081:Ptprr'
ID316894
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Nameprotein tyrosine phosphatase, receptor type, R
SynonymsPTPBR7, PTP-SL, RPTPRR
MMRRC Submission 040977-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R4081 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116018213-116274932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116236710 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 329 (K329N)
Ref Sequence ENSEMBL: ENSMUSP00000100907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
Predicted Effect probably benign
Transcript: ENSMUST00000063470
AA Change: K436N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: K436N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105271
AA Change: K329N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: K329N

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124369
Predicted Effect probably benign
Transcript: ENSMUST00000128399
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148731
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155606
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Meta Mutation Damage Score 0.0787 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adad1 A G 3: 37,064,363 probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Ccnf T C 17: 24,223,898 *778W probably null Het
Cd53 T C 3: 106,762,145 H179R probably benign Het
Cit G T 5: 115,948,050 R891L probably damaging Het
Clec4b1 T C 6: 123,069,774 probably null Het
Cntrl C A 2: 35,161,926 probably benign Het
Cntrl A G 2: 35,175,125 D2148G probably damaging Het
Cpa5 T C 6: 30,631,229 S381P probably benign Het
Crybg1 A T 10: 43,975,039 V1612D probably damaging Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2d11 A T 15: 82,391,801 I193N possibly damaging Het
Gdi2 T A 13: 3,548,866 C17S probably benign Het
Gm5436 T A 12: 84,258,715 noncoding transcript Het
Ifit1bl1 T C 19: 34,594,640 Y139C possibly damaging Het
Insr A T 8: 3,211,391 M321K probably benign Het
Ippk T A 13: 49,446,376 L237Q probably damaging Het
Itpr1 T A 6: 108,391,835 I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Myd88 G T 9: 119,339,987 probably benign Het
Myh2 T C 11: 67,190,430 S1291P probably benign Het
Mylk3 G A 8: 85,328,682 L549F probably damaging Het
Otog T C 7: 46,288,299 S1811P possibly damaging Het
Phrf1 T C 7: 141,259,057 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptprh T A 7: 4,580,988 T202S probably damaging Het
Rgl3 T A 9: 21,987,675 H156L possibly damaging Het
Sema6b A G 17: 56,128,307 V312A probably damaging Het
Sez6l T C 5: 112,461,166 I606V probably benign Het
Slco1a1 T C 6: 141,935,962 E148G probably damaging Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Sohlh1 A G 2: 25,845,722 V135A probably benign Het
Sox14 T C 9: 99,875,224 E154G possibly damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Szt2 A G 4: 118,373,567 probably benign Het
Tab2 G A 10: 7,919,831 P296S probably damaging Het
Tbx15 A G 3: 99,313,054 D48G possibly damaging Het
Tex10 T C 4: 48,468,873 S101G probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r66 A G 7: 10,274,806 I100T probably damaging Het
Vmn2r106 A T 17: 20,267,556 Y860* probably null Het
Vwa3b C T 1: 37,035,824 T24I probably damaging Het
Zfp541 G A 7: 16,072,135 S65N probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116188317 missense probably benign 0.00
IGL01762:Ptprr APN 10 116236733 missense probably damaging 1.00
IGL02429:Ptprr APN 10 116273767 missense probably damaging 0.99
IGL03396:Ptprr APN 10 116188330 missense probably damaging 1.00
R0268:Ptprr UTSW 10 116252963 missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116251158 missense probably damaging 0.96
R1388:Ptprr UTSW 10 116273752 missense probably benign 0.14
R1438:Ptprr UTSW 10 116256204 missense probably damaging 0.98
R1533:Ptprr UTSW 10 116188208 nonsense probably null
R1654:Ptprr UTSW 10 116188363 missense probably benign 0.43
R1793:Ptprr UTSW 10 116252922 missense probably damaging 1.00
R4193:Ptprr UTSW 10 116252864 missense probably damaging 1.00
R4254:Ptprr UTSW 10 116162443 splice site probably null
R4496:Ptprr UTSW 10 116229502 missense possibly damaging 0.91
R4799:Ptprr UTSW 10 116048218 missense probably benign 0.00
R5209:Ptprr UTSW 10 116162609 missense probably damaging 0.99
R5312:Ptprr UTSW 10 116188419 missense probably benign 0.28
R5410:Ptprr UTSW 10 116188330 missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116251149 missense probably damaging 0.96
R5717:Ptprr UTSW 10 116048113 missense probably benign 0.11
R6039:Ptprr UTSW 10 116236763 splice site probably null
R6039:Ptprr UTSW 10 116236763 splice site probably null
R7013:Ptprr UTSW 10 116236754 missense probably damaging 1.00
R7401:Ptprr UTSW 10 116048236 missense probably benign
R7527:Ptprr UTSW 10 116251199 missense probably benign 0.08
R7644:Ptprr UTSW 10 116048228 missense probably benign 0.00
R7651:Ptprr UTSW 10 116251179 missense probably benign 0.01
R7708:Ptprr UTSW 10 116162597 missense probably benign 0.31
R7731:Ptprr UTSW 10 116237295 missense probably damaging 1.00
R8026:Ptprr UTSW 10 116048170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAGTGTCAGAGACAGATC -3'
(R):5'- TACATGAAACACTCGCGGCC -3'

Sequencing Primer
(F):5'- GATCAAGAGACGGACACACGC -3'
(R):5'- TCGCGGCCAAATTAGAGC -3'
Posted On2015-05-15