Incidental Mutation 'R4081:Ptprr'
ID 316894
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Name protein tyrosine phosphatase receptor type R
Synonyms PTP-SL, PTPBR7, RPTPRR
MMRRC Submission 040977-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R4081 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 115854118-116110837 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116072615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 329 (K329N)
Ref Sequence ENSEMBL: ENSMUSP00000100907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
AlphaFold Q62132
Predicted Effect probably benign
Transcript: ENSMUST00000063470
AA Change: K436N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: K436N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105271
AA Change: K329N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: K329N

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124369
Predicted Effect probably benign
Transcript: ENSMUST00000128399
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148731
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155606
AA Change: K192N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: K192N

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Meta Mutation Damage Score 0.0787 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,497 (GRCm39) D324E possibly damaging Het
Adad1 A G 3: 37,118,512 (GRCm39) probably null Het
Aim2 T C 1: 173,287,417 (GRCm39) probably null Het
Arhgef1 G T 7: 24,625,271 (GRCm39) D850Y probably damaging Het
Ccnf T C 17: 24,442,872 (GRCm39) *778W probably null Het
Cd53 T C 3: 106,669,461 (GRCm39) H179R probably benign Het
Cit G T 5: 116,086,109 (GRCm39) R891L probably damaging Het
Clec4b1 T C 6: 123,046,733 (GRCm39) probably null Het
Cntrl C A 2: 35,051,938 (GRCm39) probably benign Het
Cntrl A G 2: 35,065,137 (GRCm39) D2148G probably damaging Het
Cpa5 T C 6: 30,631,228 (GRCm39) S381P probably benign Het
Crybg1 A T 10: 43,851,035 (GRCm39) V1612D probably damaging Het
Cwc25 G T 11: 97,644,744 (GRCm39) Q205K probably benign Het
Cyp2d11 A T 15: 82,276,002 (GRCm39) I193N possibly damaging Het
Gdi2 T A 13: 3,598,866 (GRCm39) C17S probably benign Het
Gm5436 T A 12: 84,305,489 (GRCm39) noncoding transcript Het
Ifit1bl1 T C 19: 34,572,040 (GRCm39) Y139C possibly damaging Het
Insr A T 8: 3,261,391 (GRCm39) M321K probably benign Het
Ippk T A 13: 49,599,852 (GRCm39) L237Q probably damaging Het
Itpr1 T A 6: 108,368,796 (GRCm39) I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lrp2 T A 2: 69,343,617 (GRCm39) H914L probably damaging Het
Myd88 G T 9: 119,169,053 (GRCm39) probably benign Het
Myh2 T C 11: 67,081,256 (GRCm39) S1291P probably benign Het
Mylk3 G A 8: 86,055,311 (GRCm39) L549F probably damaging Het
Otog T C 7: 45,937,723 (GRCm39) S1811P possibly damaging Het
Phrf1 T C 7: 140,838,970 (GRCm39) probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prorp G T 12: 55,351,398 (GRCm39) V236F possibly damaging Het
Ptprh T A 7: 4,583,987 (GRCm39) T202S probably damaging Het
Rgl3 T A 9: 21,898,971 (GRCm39) H156L possibly damaging Het
Sema6b A G 17: 56,435,307 (GRCm39) V312A probably damaging Het
Sez6l T C 5: 112,609,032 (GRCm39) I606V probably benign Het
Slco1a1 T C 6: 141,881,688 (GRCm39) E148G probably damaging Het
Snph T C 2: 151,435,722 (GRCm39) D402G probably damaging Het
Sohlh1 A G 2: 25,735,734 (GRCm39) V135A probably benign Het
Sox14 T C 9: 99,757,277 (GRCm39) E154G possibly damaging Het
Spta1 A G 1: 174,041,632 (GRCm39) D1334G probably benign Het
Stard13 C A 5: 151,016,294 (GRCm39) probably null Het
Szt2 A G 4: 118,230,764 (GRCm39) probably benign Het
Tab2 G A 10: 7,795,595 (GRCm39) P296S probably damaging Het
Tbx15 A G 3: 99,220,370 (GRCm39) D48G possibly damaging Het
Tex10 T C 4: 48,468,873 (GRCm39) S101G probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Vmn1r66 A G 7: 10,008,733 (GRCm39) I100T probably damaging Het
Vmn2r106 A T 17: 20,487,818 (GRCm39) Y860* probably null Het
Vwa3b C T 1: 37,074,905 (GRCm39) T24I probably damaging Het
Zfp541 G A 7: 15,806,060 (GRCm39) S65N probably benign Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116,024,222 (GRCm39) missense probably benign 0.00
IGL01762:Ptprr APN 10 116,072,638 (GRCm39) missense probably damaging 1.00
IGL02429:Ptprr APN 10 116,109,672 (GRCm39) missense probably damaging 0.99
IGL03396:Ptprr APN 10 116,024,235 (GRCm39) missense probably damaging 1.00
R0268:Ptprr UTSW 10 116,088,868 (GRCm39) missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116,087,063 (GRCm39) missense probably damaging 0.96
R1388:Ptprr UTSW 10 116,109,657 (GRCm39) missense probably benign 0.14
R1438:Ptprr UTSW 10 116,092,109 (GRCm39) missense probably damaging 0.98
R1533:Ptprr UTSW 10 116,024,113 (GRCm39) nonsense probably null
R1654:Ptprr UTSW 10 116,024,268 (GRCm39) missense probably benign 0.43
R1793:Ptprr UTSW 10 116,088,827 (GRCm39) missense probably damaging 1.00
R4193:Ptprr UTSW 10 116,088,769 (GRCm39) missense probably damaging 1.00
R4254:Ptprr UTSW 10 115,998,348 (GRCm39) splice site probably null
R4496:Ptprr UTSW 10 116,065,407 (GRCm39) missense possibly damaging 0.91
R4799:Ptprr UTSW 10 115,884,123 (GRCm39) missense probably benign 0.00
R5209:Ptprr UTSW 10 115,998,514 (GRCm39) missense probably damaging 0.99
R5312:Ptprr UTSW 10 116,024,324 (GRCm39) missense probably benign 0.28
R5410:Ptprr UTSW 10 116,024,235 (GRCm39) missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116,087,054 (GRCm39) missense probably damaging 0.96
R5717:Ptprr UTSW 10 115,884,018 (GRCm39) missense probably benign 0.11
R6039:Ptprr UTSW 10 116,072,668 (GRCm39) splice site probably null
R6039:Ptprr UTSW 10 116,072,668 (GRCm39) splice site probably null
R7013:Ptprr UTSW 10 116,072,659 (GRCm39) missense probably damaging 1.00
R7401:Ptprr UTSW 10 115,884,141 (GRCm39) missense probably benign
R7527:Ptprr UTSW 10 116,087,104 (GRCm39) missense probably benign 0.08
R7644:Ptprr UTSW 10 115,884,133 (GRCm39) missense probably benign 0.00
R7651:Ptprr UTSW 10 116,087,084 (GRCm39) missense probably benign 0.01
R7708:Ptprr UTSW 10 115,998,502 (GRCm39) missense probably benign 0.31
R7731:Ptprr UTSW 10 116,073,200 (GRCm39) missense probably damaging 1.00
R8026:Ptprr UTSW 10 115,884,075 (GRCm39) missense probably damaging 1.00
R8261:Ptprr UTSW 10 116,073,169 (GRCm39) missense possibly damaging 0.95
R8358:Ptprr UTSW 10 115,884,180 (GRCm39) missense probably benign 0.25
R8387:Ptprr UTSW 10 116,087,030 (GRCm39) missense probably damaging 1.00
R8894:Ptprr UTSW 10 115,884,250 (GRCm39) missense probably benign 0.00
R9142:Ptprr UTSW 10 116,024,119 (GRCm39) missense possibly damaging 0.90
R9375:Ptprr UTSW 10 116,109,724 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCAAGTGTCAGAGACAGATC -3'
(R):5'- TACATGAAACACTCGCGGCC -3'

Sequencing Primer
(F):5'- GATCAAGAGACGGACACACGC -3'
(R):5'- TCGCGGCCAAATTAGAGC -3'
Posted On 2015-05-15