Incidental Mutation 'R4081:1110008L16Rik'
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
MMRRC Submission 040977-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R4081 (G1)
Quality Score225
Status Validated
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55304613 bp
Amino Acid Change Valine to Phenylalanine at position 236 (V236F)
Ref Sequence ENSEMBL: ENSMUSP00000139252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022

PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000021411
AA Change: V236F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023
AA Change: V236F

Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183475
AA Change: V236F

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023
AA Change: V236F

low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184249
Predicted Effect possibly damaging
Transcript: ENSMUST00000184766
AA Change: V236F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023
AA Change: V236F

PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218116
Meta Mutation Damage Score 0.1603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adad1 A G 3: 37,064,363 probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Ccnf T C 17: 24,223,898 *778W probably null Het
Cd53 T C 3: 106,762,145 H179R probably benign Het
Cit G T 5: 115,948,050 R891L probably damaging Het
Clec4b1 T C 6: 123,069,774 probably null Het
Cntrl C A 2: 35,161,926 probably benign Het
Cntrl A G 2: 35,175,125 D2148G probably damaging Het
Cpa5 T C 6: 30,631,229 S381P probably benign Het
Crybg1 A T 10: 43,975,039 V1612D probably damaging Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2d11 A T 15: 82,391,801 I193N possibly damaging Het
Gdi2 T A 13: 3,548,866 C17S probably benign Het
Gm5436 T A 12: 84,258,715 noncoding transcript Het
Ifit1bl1 T C 19: 34,594,640 Y139C possibly damaging Het
Insr A T 8: 3,211,391 M321K probably benign Het
Ippk T A 13: 49,446,376 L237Q probably damaging Het
Itpr1 T A 6: 108,391,835 I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Myd88 G T 9: 119,339,987 probably benign Het
Myh2 T C 11: 67,190,430 S1291P probably benign Het
Mylk3 G A 8: 85,328,682 L549F probably damaging Het
Otog T C 7: 46,288,299 S1811P possibly damaging Het
Phrf1 T C 7: 141,259,057 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptprh T A 7: 4,580,988 T202S probably damaging Het
Ptprr A T 10: 116,236,710 K329N probably benign Het
Rgl3 T A 9: 21,987,675 H156L possibly damaging Het
Sema6b A G 17: 56,128,307 V312A probably damaging Het
Sez6l T C 5: 112,461,166 I606V probably benign Het
Slco1a1 T C 6: 141,935,962 E148G probably damaging Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Sohlh1 A G 2: 25,845,722 V135A probably benign Het
Sox14 T C 9: 99,875,224 E154G possibly damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Szt2 A G 4: 118,373,567 probably benign Het
Tab2 G A 10: 7,919,831 P296S probably damaging Het
Tbx15 A G 3: 99,313,054 D48G possibly damaging Het
Tex10 T C 4: 48,468,873 S101G probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r66 A G 7: 10,274,806 I100T probably damaging Het
Vmn2r106 A T 17: 20,267,556 Y860* probably null Het
Vwa3b C T 1: 37,035,824 T24I probably damaging Het
Zfp541 G A 7: 16,072,135 S65N probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R0892:1110008L16Rik UTSW 12 55382248 splice site probably null
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R2307:1110008L16Rik UTSW 12 55304316 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5205:1110008L16Rik UTSW 12 55304441 nonsense probably null
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
R7208:1110008L16Rik UTSW 12 55308645 splice site probably null
R7220:1110008L16Rik UTSW 12 55304415 missense possibly damaging 0.79
R7304:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7316:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7502:1110008L16Rik UTSW 12 55304421 missense probably damaging 1.00
R7908:1110008L16Rik UTSW 12 55379465 missense possibly damaging 0.56
R7967:1110008L16Rik UTSW 12 55304194 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-15