Incidental Mutation 'R4082:Col6a3'
ID316909
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 041624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4082 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90821883 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 410 (L410F)
Ref Sequence ENSEMBL: ENSMUSP00000057131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000187753] [ENSMUST00000188587]
PDB Structure Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056925
AA Change: L410F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: L410F

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130846
AA Change: L410F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: L410F

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187753
SMART Domains Protein: ENSMUSP00000140280
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:VWA 35 74 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188587
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Meta Mutation Damage Score 0.3535 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
1700021P04Rik T G 19: 24,066,002 noncoding transcript Het
a A T 2: 155,045,758 D46V probably damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Abca12 G T 1: 71,267,463 T2028K possibly damaging Het
Abt1 T C 13: 23,422,146 T213A probably benign Het
Adcy1 A C 11: 7,064,117 Y173S probably damaging Het
Aim2 T C 1: 173,459,851 probably null Het
Akr1d1 G A 6: 37,557,489 V193M probably damaging Het
Cars C T 7: 143,569,497 E461K probably damaging Het
Ccdc80 T C 16: 45,122,927 L800P probably damaging Het
Ccl22 A G 8: 94,746,908 Y27C probably damaging Het
Cdc123 G A 2: 5,810,755 probably benign Het
Cldn11 A T 3: 31,163,129 I149F probably benign Het
Col14a1 T C 15: 55,437,033 Y986H unknown Het
Crocc T C 4: 141,033,971 probably null Het
Cubn A G 2: 13,428,563 probably benign Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2e1 T C 7: 140,771,078 I321T possibly damaging Het
Eps8l1 T A 7: 4,470,798 probably null Het
Fasl C T 1: 161,781,851 V189M probably damaging Het
Fbxw5 T C 2: 25,504,631 probably null Het
Flg2 A C 3: 93,203,521 E952A unknown Het
Gpd1l A T 9: 114,917,078 L90Q probably damaging Het
Grik4 G T 9: 42,597,884 F414L probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl3 C T 13: 58,018,797 G407S probably null Het
Lmbr1 T C 5: 29,258,755 E157G probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Mrpl20 A T 4: 155,808,513 D67V probably damaging Het
Myo15 A G 11: 60,487,196 T1346A possibly damaging Het
Naip5 A T 13: 100,245,830 C124S probably damaging Het
Olfr1123 T A 2: 87,418,457 Y134* probably null Het
Olfr654 T A 7: 104,588,623 V290D probably damaging Het
Olfr702 T C 7: 106,824,038 T163A possibly damaging Het
Osbp A G 19: 11,978,666 D385G probably benign Het
Paip1 G A 13: 119,457,004 D460N probably damaging Het
Pde3b T C 7: 114,494,588 S356P probably benign Het
Pms2 A G 5: 143,931,019 M814V probably damaging Het
Polg C A 7: 79,464,828 K128N probably damaging Het
Polk G T 13: 96,483,673 T694K probably benign Het
Pom121 T C 5: 135,388,637 K342R unknown Het
Pou5f2 T C 13: 78,025,905 L322P probably damaging Het
Ptpn6 T C 6: 124,728,419 D183G probably damaging Het
Pygb G A 2: 150,826,471 probably null Het
Ralgds C T 2: 28,552,271 probably benign Het
Ret T C 6: 118,153,966 T1079A possibly damaging Het
Rspo2 A C 15: 43,022,537 V241G probably benign Het
Smg1 T A 7: 118,160,246 probably benign Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Sufu A G 19: 46,425,102 M141V probably damaging Het
Sytl2 T A 7: 90,408,427 V831D possibly damaging Het
Tc2n T C 12: 101,651,155 E335G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmcc1 T A 6: 116,043,480 H118L probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r209 A C 13: 22,805,615 L302V probably null Het
Vmn2r117 C T 17: 23,460,106 V715I probably benign Het
Vopp1 A T 6: 57,789,979 Y37* probably null Het
Xrn1 A G 9: 95,981,920 T528A probably benign Het
Zfhx2 T C 14: 55,065,205 D1774G probably benign Het
Zfp955b T A 17: 33,302,155 D199E probably benign Het
Zp2 T C 7: 120,135,252 S525G probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
Noodloid UTSW 1 90779289 missense unknown
stringy UTSW 1 90803678 nonsense probably null
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
PIT4810001:Col6a3 UTSW 1 90778794 missense unknown
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 splice site probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
R7182:Col6a3 UTSW 1 90803678 nonsense probably null
R7294:Col6a3 UTSW 1 90828283 missense probably damaging 1.00
R7296:Col6a3 UTSW 1 90827986 missense probably benign 0.00
R7311:Col6a3 UTSW 1 90822291 missense probably damaging 1.00
R7412:Col6a3 UTSW 1 90828133 missense probably damaging 0.98
R7561:Col6a3 UTSW 1 90775741 missense unknown
R7575:Col6a3 UTSW 1 90810599 missense possibly damaging 0.92
R7659:Col6a3 UTSW 1 90781745 missense unknown
R7679:Col6a3 UTSW 1 90811751 missense possibly damaging 0.49
R7831:Col6a3 UTSW 1 90796546 nonsense probably null
R7855:Col6a3 UTSW 1 90810621 missense possibly damaging 0.57
R7990:Col6a3 UTSW 1 90781855 missense unknown
R8003:Col6a3 UTSW 1 90775733 missense unknown
R8007:Col6a3 UTSW 1 90777457 missense unknown
R8098:Col6a3 UTSW 1 90803661 missense probably benign
R8312:Col6a3 UTSW 1 90813690 missense possibly damaging 0.55
R8419:Col6a3 UTSW 1 90802213 missense probably damaging 1.00
R8723:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8725:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8737:Col6a3 UTSW 1 90800025 missense probably benign 0.10
R8742:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8743:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8744:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8753:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8754:Col6a3 UTSW 1 90767606 critical splice acceptor site probably benign
R8773:Col6a3 UTSW 1 90768449 missense unknown
RF005:Col6a3 UTSW 1 90811262 missense probably benign 0.00
RF012:Col6a3 UTSW 1 90810560 missense probably damaging 1.00
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Z1177:Col6a3 UTSW 1 90811728 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GATGACTGACTGGCTGTGAG -3'
(R):5'- TGGTCCTCATAAGTGCTGGG -3'

Sequencing Primer
(F):5'- GAGTACTTACAGGTTCTCCCAAGG -3'
(R):5'- CTCATAAGTGCTGGGCCTTCTAG -3'
Posted On2015-05-15