Mutagenetix > Incidental Mutation

Incidental Mutation 'R4082:Spta1'

316912

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

041624-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.872) question?

Stock #

R4082 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

174000342-174076016 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 174041632 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1334 (D1334G)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

AlphaFold

P08032

Predicted Effect

probably benign
Transcript: ENSMUST00000027817
AA Change: D1334G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D1334G

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021P04Rik	T	G	19: 24,043,366 (GRCm39)		noncoding transcript	Het
a	A	T	2: 154,887,678 (GRCm39)	D46V	probably damaging	Het
Aass	A	T	6: 23,109,497 (GRCm39)	D324E	possibly damaging	Het
Abca12	G	T	1: 71,306,622 (GRCm39)	T2028K	possibly damaging	Het
Abt1	T	C	13: 23,606,316 (GRCm39)	T213A	probably benign	Het
Adcy1	A	C	11: 7,014,117 (GRCm39)	Y173S	probably damaging	Het
Aim2	T	C	1: 173,287,417 (GRCm39)		probably null	Het
Akr1d1	G	A	6: 37,534,424 (GRCm39)	V193M	probably damaging	Het
Cars1	C	T	7: 143,123,234 (GRCm39)	E461K	probably damaging	Het
Ccdc80	T	C	16: 44,943,290 (GRCm39)	L800P	probably damaging	Het
Ccl22	A	G	8: 95,473,536 (GRCm39)	Y27C	probably damaging	Het
Cdc123	G	A	2: 5,815,566 (GRCm39)		probably benign	Het
Cldn11	A	T	3: 31,217,278 (GRCm39)	I149F	probably benign	Het
Col14a1	T	C	15: 55,300,429 (GRCm39)	Y986H	unknown	Het
Col6a3	G	A	1: 90,749,605 (GRCm39)	L410F	probably damaging	Het
Crocc	T	C	4: 140,761,282 (GRCm39)		probably null	Het
Cubn	A	G	2: 13,433,374 (GRCm39)		probably benign	Het
Cwc25	G	T	11: 97,644,744 (GRCm39)	Q205K	probably benign	Het
Cyp2e1	T	C	7: 140,350,991 (GRCm39)	I321T	possibly damaging	Het
Eps8l1	T	A	7: 4,473,797 (GRCm39)		probably null	Het
Fasl	C	T	1: 161,609,420 (GRCm39)	V189M	probably damaging	Het
Fbxw5	T	C	2: 25,394,643 (GRCm39)		probably null	Het
Flg2	A	C	3: 93,110,828 (GRCm39)	E952A	unknown	Het
Gpd1l	A	T	9: 114,746,146 (GRCm39)	L90Q	probably damaging	Het
Grik4	G	T	9: 42,509,180 (GRCm39)	F414L	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Klhl3	C	T	13: 58,166,611 (GRCm39)	G407S	probably null	Het
Lmbr1	T	C	5: 29,463,753 (GRCm39)	E157G	probably damaging	Het
Lrp2	T	A	2: 69,343,617 (GRCm39)	H914L	probably damaging	Het
Mrpl20	A	T	4: 155,892,970 (GRCm39)	D67V	probably damaging	Het
Myo15a	A	G	11: 60,378,022 (GRCm39)	T1346A	possibly damaging	Het
Naip5	A	T	13: 100,382,338 (GRCm39)	C124S	probably damaging	Het
Or10ag2	T	A	2: 87,248,801 (GRCm39)	Y134*	probably null	Het
Or13n4	T	C	7: 106,423,245 (GRCm39)	T163A	possibly damaging	Het
Or52u1	T	A	7: 104,237,830 (GRCm39)	V290D	probably damaging	Het
Osbp	A	G	19: 11,956,030 (GRCm39)	D385G	probably benign	Het
Paip1	G	A	13: 119,593,540 (GRCm39)	D460N	probably damaging	Het
Pde3b	T	C	7: 114,093,823 (GRCm39)	S356P	probably benign	Het
Pms2	A	G	5: 143,867,837 (GRCm39)	M814V	probably damaging	Het
Polg	C	A	7: 79,114,576 (GRCm39)	K128N	probably damaging	Het
Polk	G	T	13: 96,620,181 (GRCm39)	T694K	probably benign	Het
Pom121	T	C	5: 135,417,491 (GRCm39)	K342R	unknown	Het
Pou5f2	T	C	13: 78,174,024 (GRCm39)	L322P	probably damaging	Het
Prorp	G	T	12: 55,351,398 (GRCm39)	V236F	possibly damaging	Het
Ptpn6	T	C	6: 124,705,382 (GRCm39)	D183G	probably damaging	Het
Pygb	G	A	2: 150,668,391 (GRCm39)		probably null	Het
Ralgds	C	T	2: 28,442,283 (GRCm39)		probably benign	Het
Ret	T	C	6: 118,130,927 (GRCm39)	T1079A	possibly damaging	Het
Rspo2	A	C	15: 42,885,933 (GRCm39)	V241G	probably benign	Het
Smg1	T	A	7: 117,759,469 (GRCm39)		probably benign	Het
Snph	T	C	2: 151,435,722 (GRCm39)	D402G	probably damaging	Het
Stard13	C	A	5: 151,016,294 (GRCm39)		probably null	Het
Sufu	A	G	19: 46,413,541 (GRCm39)	M141V	probably damaging	Het
Sytl2	T	A	7: 90,057,635 (GRCm39)	V831D	possibly damaging	Het
Tc2n	T	C	12: 101,617,414 (GRCm39)	E335G	possibly damaging	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Tmcc1	T	A	6: 116,020,441 (GRCm39)	H118L	probably damaging	Het
Tulp4	C	T	17: 6,282,055 (GRCm39)	H695Y	probably damaging	Het
Vmn1r209	A	C	13: 22,989,785 (GRCm39)	L302V	probably null	Het
Vmn2r117	C	T	17: 23,679,080 (GRCm39)	V715I	probably benign	Het
Vopp1	A	T	6: 57,766,964 (GRCm39)	Y37*	probably null	Het
Xrn1	A	G	9: 95,863,973 (GRCm39)	T528A	probably benign	Het
Zfhx2	T	C	14: 55,302,662 (GRCm39)	D1774G	probably benign	Het
Zfp955b	T	A	17: 33,521,129 (GRCm39)	D199E	probably benign	Het
Zp2	T	C	7: 119,734,475 (GRCm39)	S525G	probably benign	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174,035,956 (GRCm39)	nonsense	probably null
IGL01095:Spta1	APN	1	174,041,051 (GRCm39)	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174,014,829 (GRCm39)	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174,030,877 (GRCm39)	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174,044,725 (GRCm39)	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174,035,960 (GRCm39)	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174,071,746 (GRCm39)	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174,001,938 (GRCm39)	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174,041,428 (GRCm39)	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174,030,860 (GRCm39)	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174,017,797 (GRCm39)	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174,045,255 (GRCm39)	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174,002,029 (GRCm39)	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174,046,380 (GRCm39)	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174,071,676 (GRCm39)	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174,039,164 (GRCm39)	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174,014,854 (GRCm39)	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174,008,624 (GRCm39)	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174,046,309 (GRCm39)	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174,041,484 (GRCm39)	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174,041,710 (GRCm39)	missense	probably benign	0.08
bounced	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
Capillus	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
Deflection	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
Goldfoil	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
hanging	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
Klimt	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
Rutherford	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
Thread	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
H8786:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174,034,598 (GRCm39)	splice site	probably benign
R0172:Spta1	UTSW	1	174,058,352 (GRCm39)	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174,045,460 (GRCm39)	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174,070,745 (GRCm39)	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174,046,017 (GRCm39)	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174,041,508 (GRCm39)	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174,008,670 (GRCm39)	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174,001,992 (GRCm39)	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174,072,771 (GRCm39)	unclassified	probably benign
R1131:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174,039,180 (GRCm39)	nonsense	probably null
R1184:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174,050,250 (GRCm39)	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174,058,891 (GRCm39)	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174,074,919 (GRCm39)	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174,067,732 (GRCm39)	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174,012,272 (GRCm39)	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174,041,061 (GRCm39)	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174,068,608 (GRCm39)	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174,073,296 (GRCm39)	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174,074,115 (GRCm39)	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174,023,513 (GRCm39)	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174,047,405 (GRCm39)	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174,039,213 (GRCm39)	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174,071,764 (GRCm39)	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174,035,910 (GRCm39)	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174,040,180 (GRCm39)	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174,056,824 (GRCm39)	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174,020,532 (GRCm39)	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174,071,680 (GRCm39)	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174,001,907 (GRCm39)	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174,006,222 (GRCm39)	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174,068,703 (GRCm39)	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174,002,122 (GRCm39)	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174,067,923 (GRCm39)	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174,007,418 (GRCm39)	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174,074,990 (GRCm39)	nonsense	probably null
R4525:Spta1	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
R4614:Spta1	UTSW	1	174,020,543 (GRCm39)	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174,018,628 (GRCm39)	splice site	probably null
R4782:Spta1	UTSW	1	174,058,232 (GRCm39)	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174,065,493 (GRCm39)	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174,065,400 (GRCm39)	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174,045,429 (GRCm39)	splice site	probably null
R4911:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174,018,622 (GRCm39)	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174,074,174 (GRCm39)	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174,067,789 (GRCm39)	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174,075,000 (GRCm39)	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174,023,551 (GRCm39)	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174,043,095 (GRCm39)	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174,044,759 (GRCm39)	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174,003,336 (GRCm39)	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174,047,468 (GRCm39)	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174,041,821 (GRCm39)	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174,012,363 (GRCm39)	splice site	probably null
R5845:Spta1	UTSW	1	174,068,662 (GRCm39)	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174,050,894 (GRCm39)	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174,052,086 (GRCm39)	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174,009,342 (GRCm39)	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174,041,743 (GRCm39)	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174,039,212 (GRCm39)	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174,041,734 (GRCm39)	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174,030,888 (GRCm39)	missense	probably benign
R6387:Spta1	UTSW	1	174,058,899 (GRCm39)	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174,044,767 (GRCm39)	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174,014,714 (GRCm39)	splice site	probably null
R6533:Spta1	UTSW	1	174,071,713 (GRCm39)	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174,006,251 (GRCm39)	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174,036,891 (GRCm39)	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174,036,918 (GRCm39)	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174,027,050 (GRCm39)	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174,002,076 (GRCm39)	missense	probably benign
R7151:Spta1	UTSW	1	174,025,317 (GRCm39)	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174,012,178 (GRCm39)	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174,050,837 (GRCm39)	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174,050,203 (GRCm39)	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174,050,915 (GRCm39)	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
R7472:Spta1	UTSW	1	174,074,065 (GRCm39)	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174,025,349 (GRCm39)	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174,032,944 (GRCm39)	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174,023,547 (GRCm39)	nonsense	probably null
R7784:Spta1	UTSW	1	174,030,017 (GRCm39)	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174,023,471 (GRCm39)	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174,046,396 (GRCm39)	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174,025,351 (GRCm39)	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174,001,956 (GRCm39)	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174,067,737 (GRCm39)	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174,045,936 (GRCm39)	intron	probably benign
R8076:Spta1	UTSW	1	174,014,797 (GRCm39)	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174,045,510 (GRCm39)	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174,007,387 (GRCm39)	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174,074,953 (GRCm39)	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174,067,777 (GRCm39)	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174,043,051 (GRCm39)	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174,014,774 (GRCm39)	missense	probably damaging	1.00
R8675:Spta1	UTSW	1	174,058,249 (GRCm39)	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174,025,310 (GRCm39)	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174,021,145 (GRCm39)	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174,045,548 (GRCm39)	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174,058,241 (GRCm39)	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174,047,537 (GRCm39)	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174,050,174 (GRCm39)	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174,045,170 (GRCm39)	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174,058,911 (GRCm39)	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174,039,139 (GRCm39)	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174,067,750 (GRCm39)	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174,047,444 (GRCm39)	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174,045,204 (GRCm39)	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174,035,978 (GRCm39)	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174,032,925 (GRCm39)	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174,058,926 (GRCm39)	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174,036,885 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,045,469 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,041,010 (GRCm39)	missense	probably benign	0.42
T0722:Spta1	UTSW	1	174,018,632 (GRCm39)	splice site	probably benign
X0028:Spta1	UTSW	1	174,052,016 (GRCm39)	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	probably damaging	0.99
Z1176:Spta1	UTSW	1	174,018,617 (GRCm39)	missense	probably damaging	1.00
Z1177:Spta1	UTSW	1	174,073,255 (GRCm39)	missense	probably benign	0.02
Z1177:Spta1	UTSW	1	174,017,728 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- ACTGGATCAAAACCATTGGCG -3'
(R):5'- TCTCCAGAAGTTGCTATACCTGC -3'

Sequencing Primer
(F):5'- CAAAACCATTGGCGGTGTGATATC -3'
(R):5'- ATACCTGCAGTTCTAAGCACTGG -3'

Posted On

2015-05-15