Incidental Mutation 'R4082:Sytl2'
Institutional Source Beutler Lab
Gene Symbol Sytl2
Ensembl Gene ENSMUSG00000030616
Gene Namesynaptotagmin-like 2
SynonymsSlp2-a, Slp2-b, Slp2-d, Slp2-c, Slp2
MMRRC Submission 041624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4082 (G1)
Quality Score225
Status Validated
Chromosomal Location90302252-90410719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90408427 bp
Amino Acid Change Valine to Aspartic acid at position 831 (V831D)
Ref Sequence ENSEMBL: ENSMUSP00000139450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107210] [ENSMUST00000107211] [ENSMUST00000190731] [ENSMUST00000190837]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098310
SMART Domains Protein: ENSMUSP00000095912
Gene: ENSMUSG00000030616

low complexity region 938 966 N/A INTRINSIC
C2 990 1095 4.59e-15 SMART
C2 1139 1242 6.44e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107210
AA Change: V818D

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102828
Gene: ENSMUSG00000030616
AA Change: V818D

Pfam:FYVE_2 5 59 5.5e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
C2 620 725 4.59e-15 SMART
C2 769 872 6.44e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107211
AA Change: V842D

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102829
Gene: ENSMUSG00000030616
AA Change: V842D

Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 592 620 N/A INTRINSIC
C2 644 749 4.59e-15 SMART
C2 793 896 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190365
Predicted Effect possibly damaging
Transcript: ENSMUST00000190731
AA Change: V858D

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139865
Gene: ENSMUSG00000030616
AA Change: V858D

Pfam:FYVE_2 5 59 5.8e-9 PFAM
low complexity region 192 205 N/A INTRINSIC
low complexity region 317 328 N/A INTRINSIC
low complexity region 608 636 N/A INTRINSIC
C2 660 765 4.59e-15 SMART
C2 809 912 6.44e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190837
AA Change: V831D

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139450
Gene: ENSMUSG00000030616
AA Change: V831D

Pfam:FYVE_2 5 59 5.6e-9 PFAM
low complexity region 82 93 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 581 609 N/A INTRINSIC
C2 633 738 4.59e-15 SMART
C2 782 885 6.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209188
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display abnormal gastric surface mucus cell morphology and reduced basal mucin secretion from gastric cells [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
1700021P04Rik T G 19: 24,066,002 noncoding transcript Het
a A T 2: 155,045,758 D46V probably damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Abca12 G T 1: 71,267,463 T2028K possibly damaging Het
Abt1 T C 13: 23,422,146 T213A probably benign Het
Adcy1 A C 11: 7,064,117 Y173S probably damaging Het
Aim2 T C 1: 173,459,851 probably null Het
Akr1d1 G A 6: 37,557,489 V193M probably damaging Het
Cars C T 7: 143,569,497 E461K probably damaging Het
Ccdc80 T C 16: 45,122,927 L800P probably damaging Het
Ccl22 A G 8: 94,746,908 Y27C probably damaging Het
Cdc123 G A 2: 5,810,755 probably benign Het
Cldn11 A T 3: 31,163,129 I149F probably benign Het
Col14a1 T C 15: 55,437,033 Y986H unknown Het
Col6a3 G A 1: 90,821,883 L410F probably damaging Het
Crocc T C 4: 141,033,971 probably null Het
Cubn A G 2: 13,428,563 probably benign Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2e1 T C 7: 140,771,078 I321T possibly damaging Het
Eps8l1 T A 7: 4,470,798 probably null Het
Fasl C T 1: 161,781,851 V189M probably damaging Het
Fbxw5 T C 2: 25,504,631 probably null Het
Flg2 A C 3: 93,203,521 E952A unknown Het
Gpd1l A T 9: 114,917,078 L90Q probably damaging Het
Grik4 G T 9: 42,597,884 F414L probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl3 C T 13: 58,018,797 G407S probably null Het
Lmbr1 T C 5: 29,258,755 E157G probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Mrpl20 A T 4: 155,808,513 D67V probably damaging Het
Myo15 A G 11: 60,487,196 T1346A possibly damaging Het
Naip5 A T 13: 100,245,830 C124S probably damaging Het
Olfr1123 T A 2: 87,418,457 Y134* probably null Het
Olfr654 T A 7: 104,588,623 V290D probably damaging Het
Olfr702 T C 7: 106,824,038 T163A possibly damaging Het
Osbp A G 19: 11,978,666 D385G probably benign Het
Paip1 G A 13: 119,457,004 D460N probably damaging Het
Pde3b T C 7: 114,494,588 S356P probably benign Het
Pms2 A G 5: 143,931,019 M814V probably damaging Het
Polg C A 7: 79,464,828 K128N probably damaging Het
Polk G T 13: 96,483,673 T694K probably benign Het
Pom121 T C 5: 135,388,637 K342R unknown Het
Pou5f2 T C 13: 78,025,905 L322P probably damaging Het
Ptpn6 T C 6: 124,728,419 D183G probably damaging Het
Pygb G A 2: 150,826,471 probably null Het
Ralgds C T 2: 28,552,271 probably benign Het
Ret T C 6: 118,153,966 T1079A possibly damaging Het
Rspo2 A C 15: 43,022,537 V241G probably benign Het
Smg1 T A 7: 118,160,246 probably benign Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Sufu A G 19: 46,425,102 M141V probably damaging Het
Tc2n T C 12: 101,651,155 E335G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmcc1 T A 6: 116,043,480 H118L probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r209 A C 13: 22,805,615 L302V probably null Het
Vmn2r117 C T 17: 23,460,106 V715I probably benign Het
Vopp1 A T 6: 57,789,979 Y37* probably null Het
Xrn1 A G 9: 95,981,920 T528A probably benign Het
Zfhx2 T C 14: 55,065,205 D1774G probably benign Het
Zfp955b T A 17: 33,302,155 D199E probably benign Het
Zp2 T C 7: 120,135,252 S525G probably benign Het
Other mutations in Sytl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Sytl2 APN 7 90372905 missense probably benign 0.25
IGL00657:Sytl2 APN 7 90401410 missense probably benign 0.40
IGL00788:Sytl2 APN 7 90382698 intron probably benign
IGL00834:Sytl2 APN 7 90382636 intron probably benign
IGL01833:Sytl2 APN 7 90396537 missense probably damaging 0.99
IGL01866:Sytl2 APN 7 90381839 intron probably benign
IGL02215:Sytl2 APN 7 90381214 intron probably benign
IGL02934:Sytl2 APN 7 90375992 missense probably benign 0.00
IGL03095:Sytl2 APN 7 90392434 missense probably damaging 1.00
finder UTSW 7 90375652 missense probably damaging 1.00
keeper UTSW 7 90358224 nonsense probably null
R0126:Sytl2 UTSW 7 90396589 missense probably damaging 1.00
R0269:Sytl2 UTSW 7 90403020 splice site probably benign
R0270:Sytl2 UTSW 7 90403020 splice site probably benign
R0271:Sytl2 UTSW 7 90403020 splice site probably benign
R0288:Sytl2 UTSW 7 90403020 splice site probably benign
R0528:Sytl2 UTSW 7 90403020 splice site probably benign
R0601:Sytl2 UTSW 7 90395166 missense probably damaging 1.00
R0610:Sytl2 UTSW 7 90380853 intron probably benign
R1634:Sytl2 UTSW 7 90395182 missense probably damaging 1.00
R1777:Sytl2 UTSW 7 90403052 missense probably benign 0.25
R2040:Sytl2 UTSW 7 90381861 intron probably benign
R3788:Sytl2 UTSW 7 90376081 missense probably benign 0.00
R3843:Sytl2 UTSW 7 90360159 missense possibly damaging 0.77
R3952:Sytl2 UTSW 7 90381492 intron probably benign
R4600:Sytl2 UTSW 7 90375769 missense probably benign 0.11
R4651:Sytl2 UTSW 7 90375425 missense probably damaging 1.00
R4724:Sytl2 UTSW 7 90348792 start codon destroyed probably null 1.00
R4730:Sytl2 UTSW 7 90381249 intron probably benign
R4870:Sytl2 UTSW 7 90388898 missense probably damaging 1.00
R4959:Sytl2 UTSW 7 90376037 missense probably damaging 0.97
R4995:Sytl2 UTSW 7 90382257 intron probably benign
R5009:Sytl2 UTSW 7 90381315 intron probably benign
R5096:Sytl2 UTSW 7 90376082 missense possibly damaging 0.49
R5191:Sytl2 UTSW 7 90375652 missense probably damaging 1.00
R5305:Sytl2 UTSW 7 90381863 intron probably benign
R5538:Sytl2 UTSW 7 90388906 missense probably benign 0.03
R5792:Sytl2 UTSW 7 90375689 missense probably damaging 0.98
R6378:Sytl2 UTSW 7 90358224 nonsense probably null
R6982:Sytl2 UTSW 7 90396564 missense probably damaging 0.96
R7456:Sytl2 UTSW 7 90348847 missense probably damaging 1.00
R7600:Sytl2 UTSW 7 90376144 missense probably benign 0.00
R8127:Sytl2 UTSW 7 90375590 missense possibly damaging 0.93
R8171:Sytl2 UTSW 7 90409470 missense probably damaging 1.00
R8225:Sytl2 UTSW 7 90375517 missense probably benign 0.36
R8297:Sytl2 UTSW 7 90385075 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-05-15