Incidental Mutation 'R0391:Or2z8'
ID 31694
Institutional Source Beutler Lab
Gene Symbol Or2z8
Ensembl Gene ENSMUSG00000069998
Gene Name olfactory receptor family 2 subfamily Z member 8
Synonyms MOR282-1, GA_x6K02T2NUPS-191522-192466, Olfr372
MMRRC Submission 038597-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R0391 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 72811504-72812519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72812244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 240 (T240M)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
AlphaFold Q7TRY2
Predicted Effect probably damaging
Transcript: ENSMUST00000093434
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: T240M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215324
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,594,970 (GRCm39) probably benign Het
Abcc2 G A 19: 43,810,044 (GRCm39) probably benign Het
Abcc8 C G 7: 45,771,597 (GRCm39) G838A probably damaging Het
Akr1c21 G A 13: 4,631,199 (GRCm39) A245T probably damaging Het
Anapc15-ps T C 10: 95,509,139 (GRCm39) E47G probably damaging Het
Apoa1 A G 9: 46,141,140 (GRCm39) T79A probably benign Het
Atp6v1b1 A G 6: 83,733,903 (GRCm39) H378R possibly damaging Het
C4b A G 17: 34,954,588 (GRCm39) probably benign Het
Catsperd A T 17: 56,969,821 (GRCm39) E638D probably benign Het
Cckar C T 5: 53,863,595 (GRCm39) probably null Het
Cfap100 C T 6: 90,382,321 (GRCm39) probably benign Het
Chd1 G T 17: 15,970,156 (GRCm39) G970C probably damaging Het
Col14a1 A G 15: 55,309,655 (GRCm39) probably benign Het
Col17a1 C T 19: 47,652,263 (GRCm39) V698M probably damaging Het
Cpeb1 T C 7: 81,011,473 (GRCm39) D156G possibly damaging Het
Cryl1 A G 14: 57,541,232 (GRCm39) Y151H possibly damaging Het
Csmd3 C A 15: 47,520,969 (GRCm39) V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 (GRCm39) A73T probably damaging Het
Cyp2c37 T C 19: 39,982,950 (GRCm39) S180P probably damaging Het
Cyp2c54 T C 19: 40,060,613 (GRCm39) T123A possibly damaging Het
Dennd6b T C 15: 89,071,417 (GRCm39) D304G probably damaging Het
Dnmt3l T C 10: 77,887,750 (GRCm39) probably benign Het
Eci1 G A 17: 24,652,234 (GRCm39) probably null Het
Efhc1 A G 1: 21,030,412 (GRCm39) Y115C probably damaging Het
Ern1 T A 11: 106,298,004 (GRCm39) K706* probably null Het
Ghrl T C 6: 113,696,299 (GRCm39) E31G probably damaging Het
Gpr108 A C 17: 57,550,101 (GRCm39) V179G probably benign Het
Henmt1 A G 3: 108,865,851 (GRCm39) probably benign Het
Ift172 A G 5: 31,444,011 (GRCm39) V69A probably damaging Het
Il17ra T C 6: 120,453,940 (GRCm39) probably benign Het
Il17rb T C 14: 29,726,304 (GRCm39) N95D probably benign Het
Il17rb G T 14: 29,728,112 (GRCm39) probably null Het
Iqub G A 6: 24,446,154 (GRCm39) L757F probably benign Het
Itpr1 T C 6: 108,355,128 (GRCm39) V473A probably benign Het
Itpr2 T G 6: 146,131,271 (GRCm39) N1978H probably damaging Het
Klk1b26 T A 7: 43,662,151 (GRCm39) F3Y probably damaging Het
Lars1 A G 18: 42,384,428 (GRCm39) V50A probably benign Het
Lax1 G T 1: 133,607,804 (GRCm39) H312Q probably benign Het
Lctl T C 9: 64,029,596 (GRCm39) probably benign Het
Lrp2 T A 2: 69,287,202 (GRCm39) D3745V probably damaging Het
Lrp2 G A 2: 69,290,681 (GRCm39) probably benign Het
Lvrn A T 18: 46,983,533 (GRCm39) H92L probably benign Het
Marchf1 A G 8: 66,871,625 (GRCm39) T385A probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mbd5 T C 2: 49,162,428 (GRCm39) V970A possibly damaging Het
Mccc1 A G 3: 36,017,719 (GRCm39) probably benign Het
Mpp4 A T 1: 59,182,988 (GRCm39) probably benign Het
Mrnip G A 11: 50,090,747 (GRCm39) A304T probably damaging Het
Muc5b T C 7: 141,418,819 (GRCm39) S3922P possibly damaging Het
Myh3 T A 11: 66,987,333 (GRCm39) probably benign Het
Nbea A T 3: 55,944,698 (GRCm39) H555Q probably damaging Het
Niban3 T A 8: 72,055,143 (GRCm39) probably benign Het
Nlrp9c A T 7: 26,070,901 (GRCm39) probably benign Het
Nmur1 A T 1: 86,315,400 (GRCm39) V178E probably damaging Het
Nod2 T G 8: 89,390,406 (GRCm39) S238A probably benign Het
Ogfod1 A T 8: 94,789,651 (GRCm39) T451S probably damaging Het
Or1e17 T C 11: 73,831,935 (GRCm39) F288L probably damaging Het
Or2d36 T A 7: 106,747,394 (GRCm39) Y290* probably null Het
Or8b8 G A 9: 37,809,138 (GRCm39) G146D probably benign Het
Pcdh20 T C 14: 88,706,104 (GRCm39) I399V probably benign Het
Pdlim1 G T 19: 40,232,017 (GRCm39) H120Q probably damaging Het
Plg T C 17: 12,637,968 (GRCm39) V798A probably damaging Het
Polr2c A G 8: 95,584,403 (GRCm39) I39V possibly damaging Het
Ppfia2 C A 10: 106,666,575 (GRCm39) probably benign Het
Ppp1r3a A T 6: 14,719,696 (GRCm39) I406N probably benign Het
Psg28 A T 7: 18,160,098 (GRCm39) M366K probably benign Het
Rad54b T C 4: 11,601,702 (GRCm39) I419T probably damaging Het
Rnf43 A G 11: 87,622,108 (GRCm39) Q403R possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc28a3 A G 13: 58,717,229 (GRCm39) probably benign Het
Smad2 A T 18: 76,422,108 (GRCm39) probably null Het
Smad4 G A 18: 73,791,720 (GRCm39) P274S probably benign Het
Smchd1 A T 17: 71,710,149 (GRCm39) V906D probably damaging Het
Soat2 C A 15: 102,067,188 (GRCm39) R320S possibly damaging Het
Spata33 C T 8: 123,948,626 (GRCm39) A57V probably damaging Het
Stab1 A G 14: 30,865,375 (GRCm39) L1814P probably benign Het
Stab2 T C 10: 86,783,008 (GRCm39) K680R probably benign Het
Stil A G 4: 114,898,369 (GRCm39) probably null Het
Sympk T A 7: 18,780,774 (GRCm39) L759H probably benign Het
Tet1 A T 10: 62,650,325 (GRCm39) probably null Het
Tfpi2 A T 6: 3,965,460 (GRCm39) N117K probably benign Het
Tle3 A G 9: 61,323,943 (GRCm39) Y766C probably damaging Het
Trpt1 C A 19: 6,975,298 (GRCm39) probably null Het
Tshz1 A G 18: 84,034,174 (GRCm39) F78S possibly damaging Het
Ttc1 T C 11: 43,629,635 (GRCm39) D177G probably damaging Het
Ttc13 T A 8: 125,401,140 (GRCm39) Y741F probably damaging Het
Ulk3 C T 9: 57,502,115 (GRCm39) S462L probably benign Het
Utrn C T 10: 12,401,077 (GRCm39) probably benign Het
V1rd19 A C 7: 23,703,010 (GRCm39) T159P probably damaging Het
Vars1 T C 17: 35,230,462 (GRCm39) V515A possibly damaging Het
Vmn1r85 A G 7: 12,818,515 (GRCm39) Y210H probably benign Het
Vmn2r89 A G 14: 51,693,435 (GRCm39) T262A probably damaging Het
Vps53 G A 11: 76,012,405 (GRCm39) T209I probably benign Het
Wdfy2 T C 14: 63,162,582 (GRCm39) F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 (GRCm39) S694Y probably damaging Het
Zbtb8b T A 4: 129,326,463 (GRCm39) D201V probably damaging Het
Zmym5 A C 14: 57,041,908 (GRCm39) N123K possibly damaging Het
Other mutations in Or2z8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Or2z8 APN 8 72,811,920 (GRCm39) missense probably damaging 1.00
R0126:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0128:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0130:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0131:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0131:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0132:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0152:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0230:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0244:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0256:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0257:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0294:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0316:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0318:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0479:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0604:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0624:Or2z8 UTSW 8 72,812,006 (GRCm39) missense possibly damaging 0.94
R0631:Or2z8 UTSW 8 72,812,166 (GRCm39) missense probably damaging 0.99
R1785:Or2z8 UTSW 8 72,812,280 (GRCm39) missense probably damaging 1.00
R1786:Or2z8 UTSW 8 72,812,280 (GRCm39) missense probably damaging 1.00
R2040:Or2z8 UTSW 8 72,811,607 (GRCm39) missense possibly damaging 0.77
R4176:Or2z8 UTSW 8 72,812,028 (GRCm39) missense probably damaging 1.00
R4782:Or2z8 UTSW 8 72,811,938 (GRCm39) missense probably benign 0.00
R4799:Or2z8 UTSW 8 72,811,938 (GRCm39) missense probably benign 0.00
R6915:Or2z8 UTSW 8 72,811,574 (GRCm39) missense probably benign 0.19
R7512:Or2z8 UTSW 8 72,812,367 (GRCm39) missense probably damaging 1.00
R8255:Or2z8 UTSW 8 72,811,607 (GRCm39) missense possibly damaging 0.77
R9619:Or2z8 UTSW 8 72,811,605 (GRCm39) missense probably damaging 1.00
RF022:Or2z8 UTSW 8 72,812,468 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATGTGCAGACACATCAGCC -3'
(R):5'- GGATCGAAGGACATCATCGCTTCAC -3'

Sequencing Primer
(F):5'- ACATCAGCCTATGAGTTGGCG -3'
(R):5'- CAAGGACATTCGAACTTCTCTG -3'
Posted On 2013-04-24