Incidental Mutation 'R4082:Polk'
ID316956
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Namepolymerase (DNA directed), kappa
SynonymsDinb1
MMRRC Submission 041624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4082 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96480690-96542579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96483673 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 694 (T694K)
Ref Sequence ENSEMBL: ENSMUSP00000088950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]
Predicted Effect probably benign
Transcript: ENSMUST00000022172
AA Change: T753K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: T753K

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091387
AA Change: T694K

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668
AA Change: T694K

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220977
Predicted Effect probably benign
Transcript: ENSMUST00000221645
Predicted Effect probably benign
Transcript: ENSMUST00000221899
AA Change: T673K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222268
Predicted Effect probably benign
Transcript: ENSMUST00000222389
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
1700021P04Rik T G 19: 24,066,002 noncoding transcript Het
a A T 2: 155,045,758 D46V probably damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Abca12 G T 1: 71,267,463 T2028K possibly damaging Het
Abt1 T C 13: 23,422,146 T213A probably benign Het
Adcy1 A C 11: 7,064,117 Y173S probably damaging Het
Aim2 T C 1: 173,459,851 probably null Het
Akr1d1 G A 6: 37,557,489 V193M probably damaging Het
Cars C T 7: 143,569,497 E461K probably damaging Het
Ccdc80 T C 16: 45,122,927 L800P probably damaging Het
Ccl22 A G 8: 94,746,908 Y27C probably damaging Het
Cdc123 G A 2: 5,810,755 probably benign Het
Cldn11 A T 3: 31,163,129 I149F probably benign Het
Col14a1 T C 15: 55,437,033 Y986H unknown Het
Col6a3 G A 1: 90,821,883 L410F probably damaging Het
Crocc T C 4: 141,033,971 probably null Het
Cubn A G 2: 13,428,563 probably benign Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2e1 T C 7: 140,771,078 I321T possibly damaging Het
Eps8l1 T A 7: 4,470,798 probably null Het
Fasl C T 1: 161,781,851 V189M probably damaging Het
Fbxw5 T C 2: 25,504,631 probably null Het
Flg2 A C 3: 93,203,521 E952A unknown Het
Gpd1l A T 9: 114,917,078 L90Q probably damaging Het
Grik4 G T 9: 42,597,884 F414L probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl3 C T 13: 58,018,797 G407S probably null Het
Lmbr1 T C 5: 29,258,755 E157G probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Mrpl20 A T 4: 155,808,513 D67V probably damaging Het
Myo15 A G 11: 60,487,196 T1346A possibly damaging Het
Naip5 A T 13: 100,245,830 C124S probably damaging Het
Olfr1123 T A 2: 87,418,457 Y134* probably null Het
Olfr654 T A 7: 104,588,623 V290D probably damaging Het
Olfr702 T C 7: 106,824,038 T163A possibly damaging Het
Osbp A G 19: 11,978,666 D385G probably benign Het
Paip1 G A 13: 119,457,004 D460N probably damaging Het
Pde3b T C 7: 114,494,588 S356P probably benign Het
Pms2 A G 5: 143,931,019 M814V probably damaging Het
Polg C A 7: 79,464,828 K128N probably damaging Het
Pom121 T C 5: 135,388,637 K342R unknown Het
Pou5f2 T C 13: 78,025,905 L322P probably damaging Het
Ptpn6 T C 6: 124,728,419 D183G probably damaging Het
Pygb G A 2: 150,826,471 probably null Het
Ralgds C T 2: 28,552,271 probably benign Het
Ret T C 6: 118,153,966 T1079A possibly damaging Het
Rspo2 A C 15: 43,022,537 V241G probably benign Het
Smg1 T A 7: 118,160,246 probably benign Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Sufu A G 19: 46,425,102 M141V probably damaging Het
Sytl2 T A 7: 90,408,427 V831D possibly damaging Het
Tc2n T C 12: 101,651,155 E335G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmcc1 T A 6: 116,043,480 H118L probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r209 A C 13: 22,805,615 L302V probably null Het
Vmn2r117 C T 17: 23,460,106 V715I probably benign Het
Vopp1 A T 6: 57,789,979 Y37* probably null Het
Xrn1 A G 9: 95,981,920 T528A probably benign Het
Zfhx2 T C 14: 55,065,205 D1774G probably benign Het
Zfp955b T A 17: 33,302,155 D199E probably benign Het
Zp2 T C 7: 120,135,252 S525G probably benign Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96496760 missense probably benign 0.25
IGL01803:Polk APN 13 96504522 missense probably damaging 1.00
IGL01949:Polk APN 13 96483538 missense probably benign 0.10
IGL01986:Polk APN 13 96483823 missense probably benign 0.09
IGL02073:Polk APN 13 96504551 missense probably damaging 1.00
IGL03165:Polk APN 13 96516688 missense probably benign 0.23
IGL03184:Polk APN 13 96483983 missense probably benign 0.04
IGL03353:Polk APN 13 96489211 missense probably damaging 1.00
R0019:Polk UTSW 13 96504616 missense probably damaging 1.00
R0029:Polk UTSW 13 96516670 missense probably damaging 1.00
R0200:Polk UTSW 13 96496822 missense probably benign 0.11
R0357:Polk UTSW 13 96504597 missense probably damaging 0.99
R0485:Polk UTSW 13 96483764 missense probably benign 0.05
R0555:Polk UTSW 13 96484179 missense probably damaging 0.97
R0687:Polk UTSW 13 96484017 missense probably damaging 1.00
R0980:Polk UTSW 13 96483764 missense probably benign 0.05
R1065:Polk UTSW 13 96508252 missense probably damaging 1.00
R1396:Polk UTSW 13 96484208 missense probably benign 0.02
R1710:Polk UTSW 13 96489204 missense probably damaging 1.00
R1770:Polk UTSW 13 96495442 missense probably damaging 1.00
R1789:Polk UTSW 13 96496632 missense probably damaging 1.00
R1977:Polk UTSW 13 96489228 missense probably damaging 1.00
R2301:Polk UTSW 13 96484144 missense probably benign 0.09
R3797:Polk UTSW 13 96486982 splice site probably benign
R3934:Polk UTSW 13 96501635 missense possibly damaging 0.56
R4307:Polk UTSW 13 96496666 missense possibly damaging 0.79
R4472:Polk UTSW 13 96493905 missense probably damaging 1.00
R4779:Polk UTSW 13 96496491 critical splice donor site probably null
R4795:Polk UTSW 13 96489256 missense probably benign 0.01
R4796:Polk UTSW 13 96489256 missense probably benign 0.01
R4810:Polk UTSW 13 96483495 missense possibly damaging 0.90
R5002:Polk UTSW 13 96489244 missense probably damaging 1.00
R5271:Polk UTSW 13 96483539 missense probably benign 0.09
R5415:Polk UTSW 13 96483955 missense probably benign
R5459:Polk UTSW 13 96495476 missense probably damaging 1.00
R5535:Polk UTSW 13 96495497 missense probably damaging 1.00
R5619:Polk UTSW 13 96483556 missense probably damaging 1.00
R5757:Polk UTSW 13 96484252 missense probably benign 0.03
R5801:Polk UTSW 13 96483586 missense probably damaging 1.00
R5923:Polk UTSW 13 96495415 missense probably damaging 1.00
R6365:Polk UTSW 13 96484009 missense probably damaging 1.00
R6670:Polk UTSW 13 96496630 nonsense probably null
R6831:Polk UTSW 13 96495491 missense possibly damaging 0.87
R6932:Polk UTSW 13 96516681 missense probably damaging 1.00
R7216:Polk UTSW 13 96508220 missense probably benign 0.32
R7654:Polk UTSW 13 96496813 missense probably benign 0.02
R8122:Polk UTSW 13 96483783 missense probably benign 0.01
R8222:Polk UTSW 13 96495515 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACACTTACCAGTACTTCTCGAGC -3'
(R):5'- TCCACTGTGTGAGAAACGGG -3'

Sequencing Primer
(F):5'- CAGTACTTCTCGAGCTTTCTTTGGG -3'
(R):5'- AGAGATCACTTTAGTAGATGGTGTAG -3'
Posted On2015-05-15