Incidental Mutation 'R4082:Kcnh8'
ID316965
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 041624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4082 (G1)
Quality Score199
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA at 52725906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
1700021P04Rik T G 19: 24,066,002 noncoding transcript Het
a A T 2: 155,045,758 D46V probably damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Abca12 G T 1: 71,267,463 T2028K possibly damaging Het
Abt1 T C 13: 23,422,146 T213A probably benign Het
Adcy1 A C 11: 7,064,117 Y173S probably damaging Het
Aim2 T C 1: 173,459,851 probably null Het
Akr1d1 G A 6: 37,557,489 V193M probably damaging Het
Cars C T 7: 143,569,497 E461K probably damaging Het
Ccdc80 T C 16: 45,122,927 L800P probably damaging Het
Ccl22 A G 8: 94,746,908 Y27C probably damaging Het
Cdc123 G A 2: 5,810,755 probably benign Het
Cldn11 A T 3: 31,163,129 I149F probably benign Het
Col14a1 T C 15: 55,437,033 Y986H unknown Het
Col6a3 G A 1: 90,821,883 L410F probably damaging Het
Crocc T C 4: 141,033,971 probably null Het
Cubn A G 2: 13,428,563 probably benign Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2e1 T C 7: 140,771,078 I321T possibly damaging Het
Eps8l1 T A 7: 4,470,798 probably null Het
Fasl C T 1: 161,781,851 V189M probably damaging Het
Fbxw5 T C 2: 25,504,631 probably null Het
Flg2 A C 3: 93,203,521 E952A unknown Het
Gpd1l A T 9: 114,917,078 L90Q probably damaging Het
Grik4 G T 9: 42,597,884 F414L probably benign Het
Klhl3 C T 13: 58,018,797 G407S probably null Het
Lmbr1 T C 5: 29,258,755 E157G probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Mrpl20 A T 4: 155,808,513 D67V probably damaging Het
Myo15 A G 11: 60,487,196 T1346A possibly damaging Het
Naip5 A T 13: 100,245,830 C124S probably damaging Het
Olfr1123 T A 2: 87,418,457 Y134* probably null Het
Olfr654 T A 7: 104,588,623 V290D probably damaging Het
Olfr702 T C 7: 106,824,038 T163A possibly damaging Het
Osbp A G 19: 11,978,666 D385G probably benign Het
Paip1 G A 13: 119,457,004 D460N probably damaging Het
Pde3b T C 7: 114,494,588 S356P probably benign Het
Pms2 A G 5: 143,931,019 M814V probably damaging Het
Polg C A 7: 79,464,828 K128N probably damaging Het
Polk G T 13: 96,483,673 T694K probably benign Het
Pom121 T C 5: 135,388,637 K342R unknown Het
Pou5f2 T C 13: 78,025,905 L322P probably damaging Het
Ptpn6 T C 6: 124,728,419 D183G probably damaging Het
Pygb G A 2: 150,826,471 probably null Het
Ralgds C T 2: 28,552,271 probably benign Het
Ret T C 6: 118,153,966 T1079A possibly damaging Het
Rspo2 A C 15: 43,022,537 V241G probably benign Het
Smg1 T A 7: 118,160,246 probably benign Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Sufu A G 19: 46,425,102 M141V probably damaging Het
Sytl2 T A 7: 90,408,427 V831D possibly damaging Het
Tc2n T C 12: 101,651,155 E335G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmcc1 T A 6: 116,043,480 H118L probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r209 A C 13: 22,805,615 L302V probably null Het
Vmn2r117 C T 17: 23,460,106 V715I probably benign Het
Vopp1 A T 6: 57,789,979 Y37* probably null Het
Xrn1 A G 9: 95,981,920 T528A probably benign Het
Zfhx2 T C 14: 55,065,205 D1774G probably benign Het
Zfp955b T A 17: 33,302,155 D199E probably benign Het
Zp2 T C 7: 120,135,252 S525G probably benign Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGACTGAAGTTGTGTCTTAAAC -3'
(R):5'- ATGTTCCCTGGAGAACTTCTC -3'

Sequencing Primer
(F):5'- GACTGAAGTTGTGTCTTAAACAAAAG -3'
(R):5'- CTTCTCCCAAACACTATAATTGAGTG -3'
Posted On2015-05-15