Incidental Mutation 'R4083:Olfr706'
ID316979
Institutional Source Beutler Lab
Gene Symbol Olfr706
Ensembl Gene ENSMUSG00000109354
Gene Nameolfactory receptor 706
SynonymsGA_x6K02T2PBJ9-9271198-9270248, MOR283-11
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106882589-106888162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106886644 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 58 (P58T)
Ref Sequence ENSEMBL: ENSMUSP00000150075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
Predicted Effect probably damaging
Transcript: ENSMUST00000052535
AA Change: P58T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: P58T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088687
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208759
Predicted Effect probably damaging
Transcript: ENSMUST00000209025
AA Change: P58T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect probably damaging
Transcript: ENSMUST00000213918
AA Change: P58T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216099
Meta Mutation Damage Score 0.8019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Ccdc159 T C 9: 21,929,403 S89P possibly damaging Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Kdm7a T C 6: 39,152,814 E476G probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Nmur2 G C 11: 56,040,225 P220R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a16 T A 10: 40,574,069 L167Q probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Olfr706
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02311:Olfr706 APN 7 106885894 missense probably benign 0.00
IGL03093:Olfr706 APN 7 106886203 missense probably benign 0.02
IGL03354:Olfr706 APN 7 106886100 missense probably benign 0.07
R0334:Olfr706 UTSW 7 106886415 missense probably benign 0.00
R1577:Olfr706 UTSW 7 106886010 missense probably benign 0.03
R4399:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R4421:Olfr706 UTSW 7 106886453 missense probably damaging 1.00
R5202:Olfr706 UTSW 7 106886596 missense possibly damaging 0.90
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6031:Olfr706 UTSW 7 106885927 missense possibly damaging 0.93
R6375:Olfr706 UTSW 7 106886014 missense probably benign
R6475:Olfr706 UTSW 7 106886397 missense probably benign 0.00
R7665:Olfr706 UTSW 7 106886673 missense possibly damaging 0.95
R7742:Olfr706 UTSW 7 106886622 missense probably damaging 1.00
R7956:Olfr706 UTSW 7 106885971 missense possibly damaging 0.88
Z1088:Olfr706 UTSW 7 106886296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCATACTGTAGGACTCATGAAG -3'
(R):5'- ATGGAGCTCTGGAACTCCAC -3'

Sequencing Primer
(F):5'- CCTGTCATAGGCCATGAAGG -3'
(R):5'- ACCTTGGAAAGTGGCTTCATC -3'
Posted On2015-05-15