Incidental Mutation 'R4083:Nmur2'
ID316985
Institutional Source Beutler Lab
Gene Symbol Nmur2
Ensembl Gene ENSMUSG00000037393
Gene Nameneuromedin U receptor 2
Synonyms
MMRRC Submission 040978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4083 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location56024987-56041010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 56040225 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 220 (P220R)
Ref Sequence ENSEMBL: ENSMUSP00000044718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037682]
Predicted Effect probably damaging
Transcript: ENSMUST00000037682
AA Change: P220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044718
Gene: ENSMUSG00000037393
AA Change: P220R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 42 337 4.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 48 334 1.8e-13 PFAM
Pfam:7tm_1 54 319 5.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134285
Meta Mutation Damage Score 0.9431 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased chemical and thermal nociception thresholds, insensitivity to treatment with Nmu or Nms, and altered weight gain following a fast or when fed a high-fat diet that can be sex-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 31,986,784 S749P probably benign Het
Ccdc159 T C 9: 21,929,403 S89P possibly damaging Het
Cnbd1 A T 4: 18,886,042 S326T possibly damaging Het
Dpy19l1 G A 9: 24,485,048 T124M possibly damaging Het
Fmod A T 1: 134,040,305 I28F probably benign Het
Gm8674 A T 13: 49,901,011 noncoding transcript Het
Grm3 T G 5: 9,512,054 I599L probably benign Het
Hgf G T 5: 16,615,858 G668* probably null Het
Hsd17b11 A T 5: 103,990,568 V280D possibly damaging Het
Igkv8-26 G T 6: 70,193,563 S46I probably damaging Het
Kdm7a T C 6: 39,152,814 E476G probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,790,494 N437K probably benign Het
Mterf4 A C 1: 93,304,658 M157R possibly damaging Het
Nbas T C 12: 13,474,191 W1683R probably damaging Het
Olfr116 T G 17: 37,624,425 D70A probably damaging Het
Olfr706 G T 7: 106,886,644 P58T probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rab27a G T 9: 73,082,439 R64L probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc22a16 T A 10: 40,574,069 L167Q probably damaging Het
Srgap1 A G 10: 121,785,690 V989A probably damaging Het
Sstr2 T C 11: 113,625,245 V330A probably benign Het
Tdrd1 T C 19: 56,843,230 M351T probably benign Het
Trav7d-3 C A 14: 52,744,755 H84Q probably benign Het
Other mutations in Nmur2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nmur2 APN 11 56040777 missense probably damaging 0.99
IGL01591:Nmur2 APN 11 56026999 missense probably benign
IGL01960:Nmur2 APN 11 56040511 missense probably damaging 0.99
IGL02108:Nmur2 APN 11 56040364 missense probably benign 0.33
IGL02602:Nmur2 APN 11 56027063 missense probably benign 0.19
PIT4677001:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R0324:Nmur2 UTSW 11 56040520 missense probably damaging 1.00
R0458:Nmur2 UTSW 11 56040568 missense possibly damaging 0.93
R0718:Nmur2 UTSW 11 56029498 splice site probably benign
R1799:Nmur2 UTSW 11 56029621 missense probably damaging 1.00
R2099:Nmur2 UTSW 11 56040763 missense probably benign 0.00
R2263:Nmur2 UTSW 11 56029561 missense probably damaging 0.97
R3701:Nmur2 UTSW 11 56040777 missense probably damaging 0.99
R3705:Nmur2 UTSW 11 56040474 missense probably damaging 1.00
R3951:Nmur2 UTSW 11 56040225 missense probably damaging 1.00
R4744:Nmur2 UTSW 11 56040835 missense probably benign 0.01
R4747:Nmur2 UTSW 11 56040279 missense probably benign 0.05
R5288:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5384:Nmur2 UTSW 11 56040214 missense probably damaging 1.00
R5579:Nmur2 UTSW 11 56033009 missense probably benign 0.00
R6329:Nmur2 UTSW 11 56029585 missense probably benign 0.30
R6477:Nmur2 UTSW 11 56029591 missense probably damaging 1.00
R7445:Nmur2 UTSW 11 56032940 missense probably damaging 0.97
R7580:Nmur2 UTSW 11 56026982 missense probably benign 0.03
X0062:Nmur2 UTSW 11 56040849 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGAGACCAAGCTGATTTTACC -3'
(R):5'- AGCCTAGTCTGGAGCTTCTCTG -3'

Sequencing Primer
(F):5'- GAGACCAAGCTGATTTTACCTGTGAG -3'
(R):5'- CTAGTCTGGAGCTTCTCTGTGGTC -3'
Posted On2015-05-15