Mutagenetix > Incidental Mutation

Incidental Mutation 'R4084:Fmnl2'

317001

Institutional Source

Beutler Lab

Gene Symbol

Fmnl2

Ensembl Gene

ENSMUSG00000036053

Gene Name

formin-like 2

Synonyms

5430425K04Rik, man

MMRRC Submission

040857-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4084 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52857860-53133804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53107495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Isoleucine at position 486 (K486I)

Ref Sequence

ENSEMBL: ENSMUSP00000118658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]

AlphaFold

A2APV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049483
AA Change: K486I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: K486I

Domain	Start	End	E-Value	Type
Drf_GBD	23	275	1.19e-96	SMART
Drf_FH3	278	482	8.68e-76	SMART
low complexity region	518	540	N/A	INTRINSIC
SCOP:d1jvr__	549	588	8e-3	SMART
FH2	615	1052	1.66e-124	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000050719
AA Change: K486I

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: K486I

Domain	Start	End	E-Value	Type
Drf_GBD	23	275	1.19e-96	SMART
Drf_FH3	278	482	8.68e-76	SMART
low complexity region	518	540	N/A	INTRINSIC
low complexity region	549	568	N/A	INTRINSIC
FH2	581	1018	1.66e-124	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090952
AA Change: K486I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: K486I

Domain	Start	End	E-Value	Type
Drf_GBD	23	275	1.19e-96	SMART
Drf_FH3	278	482	8.68e-76	SMART
low complexity region	518	540	N/A	INTRINSIC
SCOP:d1jvr__	549	588	6e-3	SMART
FH2	615	1052	1.66e-124	SMART
low complexity region	1063	1075	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127122
AA Change: K486I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: K486I

Domain	Start	End	E-Value	Type
Drf_GBD	23	275	1.19e-96	SMART
Drf_FH3	278	482	8.68e-76	SMART
low complexity region	518	540	N/A	INTRINSIC
SCOP:d1jvr__	549	588	7e-3	SMART
FH2	615	1052	1.66e-124	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000155586
AA Change: K486I

SMART Domains

Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: K486I

Domain	Start	End	E-Value	Type
Pfam:FH2	1	131	2e-33	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl2	A	T	9: 102,724,685		probably null	Het
Arhgdig	T	C	17: 26,199,825	D114G	possibly damaging	Het
Btnl1	C	T	17: 34,381,159	T212I	possibly damaging	Het
Camkk1	C	T	11: 73,037,865	T410I	probably damaging	Het
Capn13	C	T	17: 73,337,449	G362R	probably benign	Het
Catsperd	A	G	17: 56,654,453	T392A	probably benign	Het
Ccdc180	A	G	4: 45,950,632	I1626V	probably benign	Het
Cdon	C	A	9: 35,478,131	T844K	probably damaging	Het
Col28a1	C	G	6: 8,013,132	K973N	possibly damaging	Het
Col28a1	G	A	6: 8,013,131	Q974*	probably null	Het
Dnhd1	T	C	7: 105,709,588	L3428P	probably damaging	Het
Ecm1	A	T	3: 95,734,363	N519K	probably damaging	Het
Fbxw11	T	C	11: 32,739,248	V457A	probably damaging	Het
Flna	C	T	X: 74,236,925	V1009M	possibly damaging	Het
Gja1	A	C	10: 56,388,511	Q322P	possibly damaging	Het
Gm14124	T	A	2: 150,266,202	N27K	possibly damaging	Het
Gtpbp3	A	G	8: 71,490,512	Q189R	probably benign	Het
H2-Eb1	T	C	17: 34,314,443	V213A	probably damaging	Het
Herc4	G	T	10: 63,283,237	G322V	probably damaging	Het
Hgf	G	T	5: 16,615,858	G668*	probably null	Het
Htra1	T	C	7: 130,936,344	S25P	probably benign	Het
Ifi44	A	G	3: 151,745,489		probably null	Het
Klhl24	T	A	16: 20,114,562	S308T	probably damaging	Het
Lamb2	A	G	9: 108,488,018	N1291S	probably benign	Het
Lgals9	A	T	11: 78,969,763	F162Y	possibly damaging	Het
Lig3	T	A	11: 82,795,424	I634N	probably damaging	Het
Lipn	T	C	19: 34,078,940	F229L	probably benign	Het
Lmtk3	T	A	7: 45,793,292	S466R	probably damaging	Het
Lonrf2	G	A	1: 38,821,151	T22I	probably benign	Het
Macf1	T	C	4: 123,450,072	H2119R	probably damaging	Het
Muc6	C	T	7: 141,648,655	C634Y	probably damaging	Het
Nap1l1	G	A	10: 111,490,077	V86I	possibly damaging	Het
Noxred1	A	G	12: 87,233,484	Y25H	possibly damaging	Het
Nphp4	T	C	4: 152,488,791	L62P	probably damaging	Het
Olfr1359	G	A	13: 21,703,068	W22*	probably null	Het
Olfr1359	C	A	13: 21,703,069	L23M	probably damaging	Het
Olfr599	T	G	7: 103,338,320	F89V	probably damaging	Het
Olfr745	T	A	14: 50,642,848	I189N	probably damaging	Het
Pcdh10	A	C	3: 45,392,707	D979A	probably damaging	Het
Pla2g4f	C	G	2: 120,312,325	Q101H	probably benign	Het
Ppp1r15b	T	C	1: 133,133,067	F441L	probably damaging	Het
Prkaca	C	A	8: 83,995,310	P309T	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ripor3	A	G	2: 167,984,466	Y720H	possibly damaging	Het
Rpgrip1	A	G	14: 52,149,351	E751G	possibly damaging	Het
Rsf1	GCGGCGGCGGCGGCGGC	GCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,919		probably benign	Het
Ryr3	A	G	2: 112,900,908	S686P	probably damaging	Het
Seh1l	T	C	18: 67,788,790	V240A	possibly damaging	Het
Slc10a2	T	G	8: 5,089,126	I273L	possibly damaging	Het
Slc23a2	A	T	2: 132,091,217	L107*	probably null	Het
Slc44a4	T	C	17: 34,917,347	L38P	probably damaging	Het
Slc6a18	C	T	13: 73,667,029	V387I	probably benign	Het
Slu7	G	A	11: 43,443,391	A415T	probably benign	Het
Tlr5	A	T	1: 182,974,848	R572S	possibly damaging	Het
Tmem45a2	C	T	16: 57,071,024	G3D	probably benign	Het
Trim24	A	G	6: 37,915,257	T242A	probably damaging	Het
Triobp	T	A	15: 78,973,671	N1157K	probably benign	Het
Ugt1a6a	A	T	1: 88,139,177	D235V	probably benign	Het
Vmn2r37	C	T	7: 9,215,985	V467I	probably benign	Het
Vmn2r7	C	T	3: 64,692,993	E495K	probably benign	Het
Vstm2a	A	G	11: 16,263,098	E161G	probably damaging	Het
Ypel3	T	C	7: 126,778,365	V74A	possibly damaging	Het
Zfp27	C	T	7: 29,895,367	R391H	possibly damaging	Het

Other mutations in Fmnl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fmnl2	APN	2	53114917	missense	probably damaging	1.00
IGL00960:Fmnl2	APN	2	53123482	missense	probably damaging	0.98
IGL01343:Fmnl2	APN	2	53123545	missense	probably damaging	1.00
IGL01790:Fmnl2	APN	2	53118368	missense	probably damaging	1.00
IGL02555:Fmnl2	APN	2	53126851	critical splice acceptor site	probably null
IGL02613:Fmnl2	APN	2	53073735	critical splice donor site	probably null
IGL02712:Fmnl2	APN	2	53036498	splice site	probably benign
IGL02715:Fmnl2	APN	2	53072210	missense	possibly damaging	0.93
IGL02750:Fmnl2	APN	2	53103697	missense	possibly damaging	0.95
IGL02832:Fmnl2	APN	2	52858249	missense	possibly damaging	0.90
IGL02975:Fmnl2	APN	2	53101482	missense	probably benign	0.45
Beefeater	UTSW	2	53073654	missense	unknown
waterloo	UTSW	2	53014848	missense	probably damaging	1.00
PIT4280001:Fmnl2	UTSW	2	53118196	missense	unknown
R0529:Fmnl2	UTSW	2	53042365	missense	probably damaging	1.00
R0571:Fmnl2	UTSW	2	53054491	missense	probably benign	0.01
R0707:Fmnl2	UTSW	2	53054486	missense	possibly damaging	0.85
R1172:Fmnl2	UTSW	2	53072274	missense	probably damaging	1.00
R1473:Fmnl2	UTSW	2	52858207	missense	possibly damaging	0.53
R1533:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1536:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1537:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1547:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1548:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1549:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1604:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1608:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R1615:Fmnl2	UTSW	2	53118424	missense	probably damaging	1.00
R1792:Fmnl2	UTSW	2	53042317	missense	possibly damaging	0.79
R1965:Fmnl2	UTSW	2	53114868	missense	probably damaging	1.00
R1970:Fmnl2	UTSW	2	53105576	missense	possibly damaging	0.93
R2012:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R2065:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R2111:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R2112:Fmnl2	UTSW	2	53105537	missense	probably damaging	1.00
R2427:Fmnl2	UTSW	2	53116979	missense	probably damaging	0.96
R4095:Fmnl2	UTSW	2	53101523	missense	probably damaging	0.99
R4607:Fmnl2	UTSW	2	53103716	missense	possibly damaging	0.94
R4608:Fmnl2	UTSW	2	53103716	missense	possibly damaging	0.94
R4720:Fmnl2	UTSW	2	53107540	missense	possibly damaging	0.96
R4731:Fmnl2	UTSW	2	53117069	missense	possibly damaging	0.95
R4947:Fmnl2	UTSW	2	53073710	missense	probably benign	0.32
R5015:Fmnl2	UTSW	2	53103761	missense	possibly damaging	0.85
R5402:Fmnl2	UTSW	2	53128782	missense	probably damaging	0.97
R5731:Fmnl2	UTSW	2	53118137	splice site	probably null
R5766:Fmnl2	UTSW	2	53101454	missense	probably damaging	1.00
R5945:Fmnl2	UTSW	2	53114199	missense	probably damaging	0.99
R6093:Fmnl2	UTSW	2	53114868	missense	probably damaging	1.00
R6210:Fmnl2	UTSW	2	53130445	missense	possibly damaging	0.94
R6287:Fmnl2	UTSW	2	53014848	missense	probably damaging	1.00
R6661:Fmnl2	UTSW	2	53108285	missense	probably damaging	0.98
R6967:Fmnl2	UTSW	2	53097332	missense	possibly damaging	0.88
R7006:Fmnl2	UTSW	2	53108254	missense	probably benign	0.27
R7146:Fmnl2	UTSW	2	53068540	missense
R7173:Fmnl2	UTSW	2	53114190	missense	unknown
R7176:Fmnl2	UTSW	2	53114150	missense	unknown
R7182:Fmnl2	UTSW	2	53107441	missense	unknown
R7201:Fmnl2	UTSW	2	53073654	missense	unknown
R7470:Fmnl2	UTSW	2	53042365	missense	probably damaging	1.00
R7481:Fmnl2	UTSW	2	53108431	missense	unknown
R7691:Fmnl2	UTSW	2	53101498	missense	unknown
R7699:Fmnl2	UTSW	2	53036508	missense
R7700:Fmnl2	UTSW	2	53036508	missense
R7722:Fmnl2	UTSW	2	53054467	missense
R7775:Fmnl2	UTSW	2	53073680	missense	unknown
R7824:Fmnl2	UTSW	2	53073680	missense	unknown
R8282:Fmnl2	UTSW	2	53107666	critical splice donor site	probably null
R8774:Fmnl2	UTSW	2	53042309	missense
R8774-TAIL:Fmnl2	UTSW	2	53042309	missense
R8816:Fmnl2	UTSW	2	53114202	missense	unknown
R8832:Fmnl2	UTSW	2	53054572	missense
R8868:Fmnl2	UTSW	2	53126065	missense	unknown
R8990:Fmnl2	UTSW	2	53126959	missense	unknown
R9412:Fmnl2	UTSW	2	53117004	missense	unknown
R9502:Fmnl2	UTSW	2	53108300	missense	unknown
R9532:Fmnl2	UTSW	2	53116929	missense	unknown
R9602:Fmnl2	UTSW	2	53123575	critical splice donor site	probably null
R9760:Fmnl2	UTSW	2	53054515	missense
Z1188:Fmnl2	UTSW	2	53114871	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCCTCAGTTAGCTTACCCAG -3'
(R):5'- AGGGCATCTTACCTGCTTCAG -3'

Sequencing Primer
(F):5'- GTTCTATGAAGCCAGTGTCCTGAAC -3'
(R):5'- GGCATCTTACCTGCTTCAGATGTG -3'

Posted On

2015-05-15