Incidental Mutation 'R4084:Slc23a2'
ID317005
Institutional Source Beutler Lab
Gene Symbol Slc23a2
Ensembl Gene ENSMUSG00000027340
Gene Namesolute carrier family 23 (nucleobase transporters), member 2
SynonymsSlc23a1, SVCT2, YSPL3
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132052496-132145108 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 132091217 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 107 (L107*)
Ref Sequence ENSEMBL: ENSMUSP00000028815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028815] [ENSMUST00000128899]
Predicted Effect probably null
Transcript: ENSMUST00000028815
AA Change: L107*
SMART Domains Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: L107*

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 101 534 1.7e-93 PFAM
transmembrane domain 547 566 N/A INTRINSIC
low complexity region 578 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127724
Predicted Effect probably benign
Transcript: ENSMUST00000128899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Slc23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc23a2 APN 2 132101500 missense probably benign 0.00
IGL01123:Slc23a2 APN 2 132056816 missense probably benign 0.02
IGL03115:Slc23a2 APN 2 132091265 missense probably damaging 1.00
R0352:Slc23a2 UTSW 2 132060796 missense probably benign 0.03
R0446:Slc23a2 UTSW 2 132078433 missense probably benign 0.06
R0499:Slc23a2 UTSW 2 132072017 missense probably damaging 1.00
R1252:Slc23a2 UTSW 2 132062197 splice site probably null
R1663:Slc23a2 UTSW 2 132065464 missense probably damaging 1.00
R1768:Slc23a2 UTSW 2 132075641 missense probably benign
R1914:Slc23a2 UTSW 2 132056766 missense probably damaging 0.99
R2277:Slc23a2 UTSW 2 132091259 missense possibly damaging 0.54
R2326:Slc23a2 UTSW 2 132094195 missense possibly damaging 0.72
R2385:Slc23a2 UTSW 2 132089201 missense probably benign 0.01
R4049:Slc23a2 UTSW 2 132060683 missense probably benign 0.00
R4497:Slc23a2 UTSW 2 132056782 nonsense probably null
R4710:Slc23a2 UTSW 2 132056709 missense probably benign
R4873:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R4875:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R5008:Slc23a2 UTSW 2 132101494 missense probably damaging 0.99
R5164:Slc23a2 UTSW 2 132075450 intron probably benign
R5236:Slc23a2 UTSW 2 132075584 missense probably damaging 0.97
R6587:Slc23a2 UTSW 2 132078481 missense possibly damaging 0.70
R6738:Slc23a2 UTSW 2 132078436 missense probably benign 0.10
R6960:Slc23a2 UTSW 2 132091253 missense probably damaging 1.00
R7000:Slc23a2 UTSW 2 132094203 missense possibly damaging 0.93
R7062:Slc23a2 UTSW 2 132091269 missense probably damaging 0.99
R7293:Slc23a2 UTSW 2 132089106 missense probably benign 0.02
R7324:Slc23a2 UTSW 2 132089123 missense probably damaging 1.00
X0011:Slc23a2 UTSW 2 132091263 missense possibly damaging 0.64
X0018:Slc23a2 UTSW 2 132066806 missense probably benign 0.30
Z1176:Slc23a2 UTSW 2 132060788 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGCTGTTCGGAAATTAATGTTG -3'
(R):5'- ACGGAGCTAACATCTTTCCGG -3'

Sequencing Primer
(F):5'- TGGAGTTCAGTTCCCAGAAC -3'
(R):5'- AACATCTTTCCGGGCAGTGACTAG -3'
Posted On2015-05-15