Mutagenetix > Incidental Mutation

Incidental Mutation 'R4084:Slc23a2'

317005

Institutional Source

Beutler Lab

Gene Symbol

Slc23a2

Ensembl Gene

ENSMUSG00000027340

Gene Name

solute carrier family 23 (nucleobase transporters), member 2

Synonyms

Slc23a1, SVCT2, YSPL3

MMRRC Submission

040857-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4084 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

132052496-132145108 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 132091217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 107 (L107*)

Ref Sequence

ENSEMBL: ENSMUSP00000028815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028815] [ENSMUST00000128899]

AlphaFold

Q9EPR4

Predicted Effect

probably null
Transcript: ENSMUST00000028815
AA Change: L107*

SMART Domains

Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: L107*

Domain	Start	End	E-Value	Type
Pfam:Xan_ur_permease	101	534	1.7e-93	PFAM
transmembrane domain	547	566	N/A	INTRINSIC
low complexity region	578	592	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127724

Predicted Effect

probably benign
Transcript: ENSMUST00000128899

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133407

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl2	A	T	9: 102,724,685		probably null	Het
Arhgdig	T	C	17: 26,199,825	D114G	possibly damaging	Het
Btnl1	C	T	17: 34,381,159	T212I	possibly damaging	Het
Camkk1	C	T	11: 73,037,865	T410I	probably damaging	Het
Capn13	C	T	17: 73,337,449	G362R	probably benign	Het
Catsperd	A	G	17: 56,654,453	T392A	probably benign	Het
Ccdc180	A	G	4: 45,950,632	I1626V	probably benign	Het
Cdon	C	A	9: 35,478,131	T844K	probably damaging	Het
Col28a1	G	A	6: 8,013,131	Q974*	probably null	Het
Col28a1	C	G	6: 8,013,132	K973N	possibly damaging	Het
Dnhd1	T	C	7: 105,709,588	L3428P	probably damaging	Het
Ecm1	A	T	3: 95,734,363	N519K	probably damaging	Het
Fbxw11	T	C	11: 32,739,248	V457A	probably damaging	Het
Flna	C	T	X: 74,236,925	V1009M	possibly damaging	Het
Fmnl2	A	T	2: 53,107,495	K486I	possibly damaging	Het
Gja1	A	C	10: 56,388,511	Q322P	possibly damaging	Het
Gm14124	T	A	2: 150,266,202	N27K	possibly damaging	Het
Gtpbp3	A	G	8: 71,490,512	Q189R	probably benign	Het
H2-Eb1	T	C	17: 34,314,443	V213A	probably damaging	Het
Herc4	G	T	10: 63,283,237	G322V	probably damaging	Het
Hgf	G	T	5: 16,615,858	G668*	probably null	Het
Htra1	T	C	7: 130,936,344	S25P	probably benign	Het
Ifi44	A	G	3: 151,745,489		probably null	Het
Klhl24	T	A	16: 20,114,562	S308T	probably damaging	Het
Lamb2	A	G	9: 108,488,018	N1291S	probably benign	Het
Lgals9	A	T	11: 78,969,763	F162Y	possibly damaging	Het
Lig3	T	A	11: 82,795,424	I634N	probably damaging	Het
Lipn	T	C	19: 34,078,940	F229L	probably benign	Het
Lmtk3	T	A	7: 45,793,292	S466R	probably damaging	Het
Lonrf2	G	A	1: 38,821,151	T22I	probably benign	Het
Macf1	T	C	4: 123,450,072	H2119R	probably damaging	Het
Muc6	C	T	7: 141,648,655	C634Y	probably damaging	Het
Nap1l1	G	A	10: 111,490,077	V86I	possibly damaging	Het
Noxred1	A	G	12: 87,233,484	Y25H	possibly damaging	Het
Nphp4	T	C	4: 152,488,791	L62P	probably damaging	Het
Olfr1359	G	A	13: 21,703,068	W22*	probably null	Het
Olfr1359	C	A	13: 21,703,069	L23M	probably damaging	Het
Olfr599	T	G	7: 103,338,320	F89V	probably damaging	Het
Olfr745	T	A	14: 50,642,848	I189N	probably damaging	Het
Pcdh10	A	C	3: 45,392,707	D979A	probably damaging	Het
Pla2g4f	C	G	2: 120,312,325	Q101H	probably benign	Het
Ppp1r15b	T	C	1: 133,133,067	F441L	probably damaging	Het
Prkaca	C	A	8: 83,995,310	P309T	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ripor3	A	G	2: 167,984,466	Y720H	possibly damaging	Het
Rpgrip1	A	G	14: 52,149,351	E751G	possibly damaging	Het
Rsf1	GCGGCGGCGGCGGCGGC	GCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,919		probably benign	Het
Ryr3	A	G	2: 112,900,908	S686P	probably damaging	Het
Seh1l	T	C	18: 67,788,790	V240A	possibly damaging	Het
Slc10a2	T	G	8: 5,089,126	I273L	possibly damaging	Het
Slc44a4	T	C	17: 34,917,347	L38P	probably damaging	Het
Slc6a18	C	T	13: 73,667,029	V387I	probably benign	Het
Slu7	G	A	11: 43,443,391	A415T	probably benign	Het
Tlr5	A	T	1: 182,974,848	R572S	possibly damaging	Het
Tmem45a2	C	T	16: 57,071,024	G3D	probably benign	Het
Trim24	A	G	6: 37,915,257	T242A	probably damaging	Het
Triobp	T	A	15: 78,973,671	N1157K	probably benign	Het
Ugt1a6a	A	T	1: 88,139,177	D235V	probably benign	Het
Vmn2r37	C	T	7: 9,215,985	V467I	probably benign	Het
Vmn2r7	C	T	3: 64,692,993	E495K	probably benign	Het
Vstm2a	A	G	11: 16,263,098	E161G	probably damaging	Het
Ypel3	T	C	7: 126,778,365	V74A	possibly damaging	Het
Zfp27	C	T	7: 29,895,367	R391H	possibly damaging	Het

Other mutations in Slc23a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Slc23a2	APN	2	132101500	missense	probably benign	0.00
IGL01123:Slc23a2	APN	2	132056816	missense	probably benign	0.02
IGL03115:Slc23a2	APN	2	132091265	missense	probably damaging	1.00
R0352:Slc23a2	UTSW	2	132060796	missense	probably benign	0.03
R0446:Slc23a2	UTSW	2	132078433	missense	probably benign	0.06
R0499:Slc23a2	UTSW	2	132072017	missense	probably damaging	1.00
R1252:Slc23a2	UTSW	2	132062197	splice site	probably null
R1663:Slc23a2	UTSW	2	132065464	missense	probably damaging	1.00
R1768:Slc23a2	UTSW	2	132075641	missense	probably benign
R1914:Slc23a2	UTSW	2	132056766	missense	probably damaging	0.99
R2277:Slc23a2	UTSW	2	132091259	missense	possibly damaging	0.54
R2326:Slc23a2	UTSW	2	132094195	missense	possibly damaging	0.72
R2385:Slc23a2	UTSW	2	132089201	missense	probably benign	0.01
R4049:Slc23a2	UTSW	2	132060683	missense	probably benign	0.00
R4497:Slc23a2	UTSW	2	132056782	nonsense	probably null
R4710:Slc23a2	UTSW	2	132056709	missense	probably benign
R4873:Slc23a2	UTSW	2	132056880	missense	possibly damaging	0.75
R4875:Slc23a2	UTSW	2	132056880	missense	possibly damaging	0.75
R5008:Slc23a2	UTSW	2	132101494	missense	probably damaging	0.99
R5164:Slc23a2	UTSW	2	132075450	intron	probably benign
R5236:Slc23a2	UTSW	2	132075584	missense	probably damaging	0.97
R6587:Slc23a2	UTSW	2	132078481	missense	possibly damaging	0.70
R6738:Slc23a2	UTSW	2	132078436	missense	probably benign	0.10
R6960:Slc23a2	UTSW	2	132091253	missense	probably damaging	1.00
R7000:Slc23a2	UTSW	2	132094203	missense	possibly damaging	0.93
R7062:Slc23a2	UTSW	2	132091269	missense	probably damaging	0.99
R7293:Slc23a2	UTSW	2	132089106	missense	probably benign	0.02
R7324:Slc23a2	UTSW	2	132089123	missense	probably damaging	1.00
R8077:Slc23a2	UTSW	2	132089172	missense	possibly damaging	0.51
R8794:Slc23a2	UTSW	2	132060709	missense	probably benign	0.01
R8839:Slc23a2	UTSW	2	132101472	splice site	silent
R8882:Slc23a2	UTSW	2	132091239	missense	possibly damaging	0.82
R9129:Slc23a2	UTSW	2	132078412	critical splice donor site	probably null
R9252:Slc23a2	UTSW	2	132071922	missense	probably damaging	1.00
R9597:Slc23a2	UTSW	2	132062178	missense	not run
X0011:Slc23a2	UTSW	2	132091263	missense	possibly damaging	0.64
X0018:Slc23a2	UTSW	2	132066806	missense	probably benign	0.30
Z1176:Slc23a2	UTSW	2	132060788	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGCTGTTCGGAAATTAATGTTG -3'
(R):5'- ACGGAGCTAACATCTTTCCGG -3'

Sequencing Primer
(F):5'- TGGAGTTCAGTTCCCAGAAC -3'
(R):5'- AACATCTTTCCGGGCAGTGACTAG -3'

Posted On

2015-05-15