Mutagenetix > Incidental Mutations

Incidental Mutation 'R4084:Nphp4'

317015

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

040857-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R4084 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 152488791 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 62 (L62P)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056567
AA Change: L62P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: L62P

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081393
AA Change: L62P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: L62P

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153759

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl2	A	T	9: 102,724,685		probably null	Het
Arhgdig	T	C	17: 26,199,825	D114G	possibly damaging	Het
Btnl1	C	T	17: 34,381,159	T212I	possibly damaging	Het
Camkk1	C	T	11: 73,037,865	T410I	probably damaging	Het
Capn13	C	T	17: 73,337,449	G362R	probably benign	Het
Catsperd	A	G	17: 56,654,453	T392A	probably benign	Het
Ccdc180	A	G	4: 45,950,632	I1626V	probably benign	Het
Cdon	C	A	9: 35,478,131	T844K	probably damaging	Het
Col28a1	G	A	6: 8,013,131	Q974*	probably null	Het
Col28a1	C	G	6: 8,013,132	K973N	possibly damaging	Het
Dnhd1	T	C	7: 105,709,588	L3428P	probably damaging	Het
Ecm1	A	T	3: 95,734,363	N519K	probably damaging	Het
Fbxw11	T	C	11: 32,739,248	V457A	probably damaging	Het
Flna	C	T	X: 74,236,925	V1009M	possibly damaging	Het
Fmnl2	A	T	2: 53,107,495	K486I	possibly damaging	Het
Gja1	A	C	10: 56,388,511	Q322P	possibly damaging	Het
Gm14124	T	A	2: 150,266,202	N27K	possibly damaging	Het
Gtpbp3	A	G	8: 71,490,512	Q189R	probably benign	Het
H2-Eb1	T	C	17: 34,314,443	V213A	probably damaging	Het
Herc4	G	T	10: 63,283,237	G322V	probably damaging	Het
Hgf	G	T	5: 16,615,858	G668*	probably null	Het
Htra1	T	C	7: 130,936,344	S25P	probably benign	Het
Ifi44	A	G	3: 151,745,489		probably null	Het
Klhl24	T	A	16: 20,114,562	S308T	probably damaging	Het
Lamb2	A	G	9: 108,488,018	N1291S	probably benign	Het
Lgals9	A	T	11: 78,969,763	F162Y	possibly damaging	Het
Lig3	T	A	11: 82,795,424	I634N	probably damaging	Het
Lipn	T	C	19: 34,078,940	F229L	probably benign	Het
Lmtk3	T	A	7: 45,793,292	S466R	probably damaging	Het
Lonrf2	G	A	1: 38,821,151	T22I	probably benign	Het
Macf1	T	C	4: 123,450,072	H2119R	probably damaging	Het
Muc6	C	T	7: 141,648,655	C634Y	probably damaging	Het
Nap1l1	G	A	10: 111,490,077	V86I	possibly damaging	Het
Noxred1	A	G	12: 87,233,484	Y25H	possibly damaging	Het
Olfr1359	G	A	13: 21,703,068	W22*	probably null	Het
Olfr1359	C	A	13: 21,703,069	L23M	probably damaging	Het
Olfr599	T	G	7: 103,338,320	F89V	probably damaging	Het
Olfr745	T	A	14: 50,642,848	I189N	probably damaging	Het
Pcdh10	A	C	3: 45,392,707	D979A	probably damaging	Het
Pla2g4f	C	G	2: 120,312,325	Q101H	probably benign	Het
Ppp1r15b	T	C	1: 133,133,067	F441L	probably damaging	Het
Prkaca	C	A	8: 83,995,310	P309T	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ripor3	A	G	2: 167,984,466	Y720H	possibly damaging	Het
Rpgrip1	A	G	14: 52,149,351	E751G	possibly damaging	Het
Rsf1	GCGGCGGCGGCGGCGGC	GCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,919		probably benign	Het
Ryr3	A	G	2: 112,900,908	S686P	probably damaging	Het
Seh1l	T	C	18: 67,788,790	V240A	possibly damaging	Het
Slc10a2	T	G	8: 5,089,126	I273L	possibly damaging	Het
Slc23a2	A	T	2: 132,091,217	L107*	probably null	Het
Slc44a4	T	C	17: 34,917,347	L38P	probably damaging	Het
Slc6a18	C	T	13: 73,667,029	V387I	probably benign	Het
Slu7	G	A	11: 43,443,391	A415T	probably benign	Het
Tlr5	A	T	1: 182,974,848	R572S	possibly damaging	Het
Tmem45a2	C	T	16: 57,071,024	G3D	probably benign	Het
Trim24	A	G	6: 37,915,257	T242A	probably damaging	Het
Triobp	T	A	15: 78,973,671	N1157K	probably benign	Het
Ugt1a6a	A	T	1: 88,139,177	D235V	probably benign	Het
Vmn2r37	C	T	7: 9,215,985	V467I	probably benign	Het
Vmn2r7	C	T	3: 64,692,993	E495K	probably benign	Het
Vstm2a	A	G	11: 16,263,098	E161G	probably damaging	Het
Ypel3	T	C	7: 126,778,365	V74A	possibly damaging	Het
Zfp27	C	T	7: 29,895,367	R391H	possibly damaging	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1203:Nphp4	UTSW	4	152488832	missense	probably damaging	0.96
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1452:Nphp4	UTSW	4	152547018	missense	probably damaging	0.99
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2281:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4240:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7124:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
R7638:Nphp4	UTSW	4	152554534	missense	probably benign	0.08
R7814:Nphp4	UTSW	4	152524272	missense	possibly damaging	0.93
R7814:Nphp4	UTSW	4	152544403	missense	probably damaging	1.00
R7841:Nphp4	UTSW	4	152496683	missense	probably benign	0.01
R8346:Nphp4	UTSW	4	152561321	missense	probably damaging	1.00
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95
Z1177:Nphp4	UTSW	4	152518196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAAGGAAGTTGAGTTGCCAG -3'
(R):5'- TTGGAAACAGAGTGTCCCAC -3'

Sequencing Primer
(F):5'- AAGTTGAGTTGCCAGTAGCTGAATG -3'
(R):5'- GTGTCCCACTACTAAGACAAGCTTG -3'

Posted On

2015-05-15