Incidental Mutation 'R4084:Hgf'
ID317016
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 16615858 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 668 (G668*)
Ref Sequence ENSEMBL: ENSMUSP00000143424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
Predicted Effect probably null
Transcript: ENSMUST00000030683
AA Change: G668*
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: G668*

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196645
AA Change: G663*
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199581
AA Change: G668*
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: G668*

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16611862 missense probably damaging 1.00
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R1983:Hgf UTSW 5 16561012 missense possibly damaging 0.53
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4388:Hgf UTSW 5 16614943 missense probably benign 0.12
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 splice site probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7296:Hgf UTSW 5 16564843 missense probably benign 0.39
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
R8098:Hgf UTSW 5 16561061 missense probably benign 0.04
R8120:Hgf UTSW 5 16613781 missense probably damaging 1.00
R8132:Hgf UTSW 5 16602331 missense probably damaging 1.00
R8499:Hgf UTSW 5 16566856 missense probably damaging 0.99
R8929:Hgf UTSW 5 16593990 missense not run
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACGCTCATTAAACTGTCTG -3'
(R):5'- GCACTTCTTTAGAGGAATAGGTTGG -3'

Sequencing Primer
(F):5'- AATGCAGTCAGCACCATC -3'
(R):5'- AGGAATAGGTTGGTTTTCAAGTATC -3'
Posted On2015-05-15