Incidental Mutation 'R4084:Lmtk3'
ID317022
Institutional Source Beutler Lab
Gene Symbol Lmtk3
Ensembl Gene ENSMUSG00000062044
Gene Namelemur tyrosine kinase 3
SynonymsAATYK3, Aatyk3
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45783738-45804144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45793292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 466 (S466R)
Ref Sequence ENSEMBL: ENSMUSP00000148041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701]
Predicted Effect probably damaging
Transcript: ENSMUST00000072580
AA Change: S440R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: S440R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118564
AA Change: S466R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113323
Gene: ENSMUSG00000062044
AA Change: S466R

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Pkinase_Tyr 159 434 4.2e-64 PFAM
Pfam:Pkinase 159 436 1.3e-33 PFAM
low complexity region 441 470 N/A INTRINSIC
low complexity region 510 532 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 665 695 N/A INTRINSIC
low complexity region 761 817 N/A INTRINSIC
low complexity region 823 869 N/A INTRINSIC
low complexity region 1107 1131 N/A INTRINSIC
low complexity region 1142 1158 N/A INTRINSIC
low complexity region 1222 1249 N/A INTRINSIC
low complexity region 1251 1289 N/A INTRINSIC
low complexity region 1371 1388 N/A INTRINSIC
low complexity region 1410 1419 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120005
AA Change: S440R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: S440R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209351
Predicted Effect probably damaging
Transcript: ENSMUST00000209617
AA Change: S466R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209701
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Lmtk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lmtk3 APN 7 45790907 missense probably damaging 1.00
IGL01996:Lmtk3 APN 7 45793447 unclassified probably null
IGL02146:Lmtk3 APN 7 45794947 unclassified probably benign
IGL02192:Lmtk3 APN 7 45794509 unclassified probably benign
IGL02598:Lmtk3 APN 7 45793140 missense probably damaging 1.00
R0469:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0510:Lmtk3 UTSW 7 45794112 missense possibly damaging 0.95
R0603:Lmtk3 UTSW 7 45795556 unclassified probably benign
R0781:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1110:Lmtk3 UTSW 7 45795003 unclassified probably benign
R1270:Lmtk3 UTSW 7 45793828 missense probably damaging 0.96
R1535:Lmtk3 UTSW 7 45794570 unclassified probably benign
R1666:Lmtk3 UTSW 7 45794164 missense probably benign 0.03
R1807:Lmtk3 UTSW 7 45793278 missense probably benign 0.02
R1883:Lmtk3 UTSW 7 45786849 missense probably damaging 1.00
R2060:Lmtk3 UTSW 7 45800911 critical splice acceptor site probably null
R2107:Lmtk3 UTSW 7 45793969 missense possibly damaging 0.56
R2214:Lmtk3 UTSW 7 45794853 unclassified probably benign
R2369:Lmtk3 UTSW 7 45795088 unclassified probably benign
R4246:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4247:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4249:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4250:Lmtk3 UTSW 7 45794062 missense possibly damaging 0.75
R4587:Lmtk3 UTSW 7 45794080 missense possibly damaging 0.92
R5026:Lmtk3 UTSW 7 45794412 unclassified probably benign
R5275:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5295:Lmtk3 UTSW 7 45791298 missense probably damaging 1.00
R5624:Lmtk3 UTSW 7 45786862 missense probably damaging 0.96
R5688:Lmtk3 UTSW 7 45791410 missense probably damaging 1.00
R6478:Lmtk3 UTSW 7 45798589 missense unknown
R6737:Lmtk3 UTSW 7 45793627 missense probably damaging 0.99
R6800:Lmtk3 UTSW 7 45793809 missense possibly damaging 0.91
R6856:Lmtk3 UTSW 7 45794297 unclassified probably benign
R7319:Lmtk3 UTSW 7 45794316 missense unknown
R7335:Lmtk3 UTSW 7 45795157 missense unknown
R7353:Lmtk3 UTSW 7 45788000 missense possibly damaging 0.46
R7621:Lmtk3 UTSW 7 45793417 missense probably damaging 1.00
R7699:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
R7700:Lmtk3 UTSW 7 45792574 missense probably damaging 1.00
X0052:Lmtk3 UTSW 7 45793498 missense probably benign 0.03
X0067:Lmtk3 UTSW 7 45794680 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTATGACATTTTGCAGTCTTG -3'
(R):5'- GCGCCTCATAGAAGGGATTG -3'

Sequencing Primer
(F):5'- GCAGTCTTGCTGGCGGC -3'
(R):5'- CCTCATAGAAGGGATTGGATGGATTG -3'
Posted On2015-05-15