Incidental Mutation 'R4084:Lamb2'
ID317032
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
MMRRC Submission 040857-MU
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108488018 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1291 (N1291S)
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
AA Change: N1291S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: N1291S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193301
Predicted Effect probably benign
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0452:Lamb2 UTSW 9 108486354 unclassified probably benign
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1678:Lamb2 UTSW 9 108483686 critical splice acceptor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7116:Lamb2 UTSW 9 108487323 missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108488324 missense probably benign 0.20
R7404:Lamb2 UTSW 9 108487583 missense probably damaging 1.00
R7456:Lamb2 UTSW 9 108485780 missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108486148 missense probably benign 0.01
R7623:Lamb2 UTSW 9 108489224 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GAAGCTTGTAGAGGCCACAG -3'
(R):5'- TGCTGTCATAGGCACCTAAG -3'

Sequencing Primer
(F):5'- CCACAGAGGGACTACGGTAC -3'
(R):5'- CATAGGCACCTAAGTTGGGTC -3'
Posted On2015-05-15