Incidental Mutation 'R4084:Slu7'
ID317038
Institutional Source Beutler Lab
Gene Symbol Slu7
Ensembl Gene ENSMUSG00000020409
Gene NameSLU7 splicing factor homolog (S. cerevisiae)
SynonymsD3Bwg0878e, D11Ertd730e
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location43433744-43447981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43443391 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 415 (A415T)
Ref Sequence ENSEMBL: ENSMUSP00000116609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020681] [ENSMUST00000151880] [ENSMUST00000178622]
Predicted Effect probably benign
Transcript: ENSMUST00000020681
AA Change: A415T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020681
Gene: ENSMUSG00000020409
AA Change: A415T

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 1.3e-90 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149402
Predicted Effect probably benign
Transcript: ENSMUST00000151880
AA Change: A415T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116609
Gene: ENSMUSG00000020409
AA Change: A415T

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 2.4e-91 PFAM
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178622
AA Change: A415T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137281
Gene: ENSMUSG00000020409
AA Change: A415T

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 161 434 1.6e-112 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Slu7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Slu7 APN 11 43439260 missense probably damaging 1.00
IGL02212:Slu7 APN 11 43440642 missense probably benign 0.05
IGL02657:Slu7 APN 11 43442022 splice site probably null
IGL02671:Slu7 APN 11 43445475 splice site probably null
IGL02702:Slu7 APN 11 43438892 splice site probably benign
IGL02720:Slu7 APN 11 43445203 missense probably benign 0.00
IGL02831:Slu7 APN 11 43442653 nonsense probably null
IGL03104:Slu7 APN 11 43442056 missense probably benign 0.36
IGL03106:Slu7 APN 11 43442630 missense possibly damaging 0.46
R0571:Slu7 UTSW 11 43441578 critical splice donor site probably null
R1498:Slu7 UTSW 11 43438217 missense possibly damaging 0.78
R1753:Slu7 UTSW 11 43439268 missense probably benign 0.40
R1789:Slu7 UTSW 11 43445242 missense probably benign 0.00
R2655:Slu7 UTSW 11 43440648 missense probably benign 0.03
R2941:Slu7 UTSW 11 43444757 missense probably benign 0.06
R3916:Slu7 UTSW 11 43440684 splice site probably null
R3917:Slu7 UTSW 11 43440684 splice site probably null
R4393:Slu7 UTSW 11 43439269 missense possibly damaging 0.89
R5656:Slu7 UTSW 11 43443418 missense probably benign 0.03
R5884:Slu7 UTSW 11 43443418 missense probably benign 0.03
R6320:Slu7 UTSW 11 43441489 missense probably benign 0.22
R6517:Slu7 UTSW 11 43438148 missense probably damaging 1.00
R7763:Slu7 UTSW 11 43444765 missense probably damaging 1.00
R7893:Slu7 UTSW 11 43444836 splice site probably null
R8023:Slu7 UTSW 11 43446148 missense probably benign 0.23
R8251:Slu7 UTSW 11 43439301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAACTTCTTATTTACCCGGAAAG -3'
(R):5'- ATTCTGGGTAAGCATGCAGATG -3'

Sequencing Primer
(F):5'- CTTTAGTACGGTGGCCA -3'
(R):5'- ATGGTCAGCCTGCTCAA -3'
Posted On2015-05-15