Mutagenetix > Incidental Mutations

Incidental Mutation 'R4084:Capn13'

317057

Institutional Source

Beutler Lab

Gene Symbol

Capn13

Ensembl Gene

ENSMUSG00000043705

Gene Name

calpain 13

Synonyms

LOC381122

MMRRC Submission

040857-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4084 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73306464-73399296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73337449 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 362 (G362R)

Ref Sequence

ENSEMBL: ENSMUSP00000092832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095208]

Predicted Effect

probably benign
Transcript: ENSMUST00000095208
AA Change: G362R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: G362R

Domain	Start	End	E-Value	Type
CysPc	12	337	3.23e-113	SMART
Pfam:Calpain_III	341	473	2e-13	PFAM
SCOP:d1k94a_	512	664	3e-8	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl2	A	T	9: 102,724,685		probably null	Het
Arhgdig	T	C	17: 26,199,825	D114G	possibly damaging	Het
Btnl1	C	T	17: 34,381,159	T212I	possibly damaging	Het
Camkk1	C	T	11: 73,037,865	T410I	probably damaging	Het
Catsperd	A	G	17: 56,654,453	T392A	probably benign	Het
Ccdc180	A	G	4: 45,950,632	I1626V	probably benign	Het
Cdon	C	A	9: 35,478,131	T844K	probably damaging	Het
Col28a1	G	A	6: 8,013,131	Q974*	probably null	Het
Col28a1	C	G	6: 8,013,132	K973N	possibly damaging	Het
Dnhd1	T	C	7: 105,709,588	L3428P	probably damaging	Het
Ecm1	A	T	3: 95,734,363	N519K	probably damaging	Het
Fbxw11	T	C	11: 32,739,248	V457A	probably damaging	Het
Flna	C	T	X: 74,236,925	V1009M	possibly damaging	Het
Fmnl2	A	T	2: 53,107,495	K486I	possibly damaging	Het
Gja1	A	C	10: 56,388,511	Q322P	possibly damaging	Het
Gm14124	T	A	2: 150,266,202	N27K	possibly damaging	Het
Gtpbp3	A	G	8: 71,490,512	Q189R	probably benign	Het
H2-Eb1	T	C	17: 34,314,443	V213A	probably damaging	Het
Herc4	G	T	10: 63,283,237	G322V	probably damaging	Het
Hgf	G	T	5: 16,615,858	G668*	probably null	Het
Htra1	T	C	7: 130,936,344	S25P	probably benign	Het
Ifi44	A	G	3: 151,745,489		probably null	Het
Klhl24	T	A	16: 20,114,562	S308T	probably damaging	Het
Lamb2	A	G	9: 108,488,018	N1291S	probably benign	Het
Lgals9	A	T	11: 78,969,763	F162Y	possibly damaging	Het
Lig3	T	A	11: 82,795,424	I634N	probably damaging	Het
Lipn	T	C	19: 34,078,940	F229L	probably benign	Het
Lmtk3	T	A	7: 45,793,292	S466R	probably damaging	Het
Lonrf2	G	A	1: 38,821,151	T22I	probably benign	Het
Macf1	T	C	4: 123,450,072	H2119R	probably damaging	Het
Muc6	C	T	7: 141,648,655	C634Y	probably damaging	Het
Nap1l1	G	A	10: 111,490,077	V86I	possibly damaging	Het
Noxred1	A	G	12: 87,233,484	Y25H	possibly damaging	Het
Nphp4	T	C	4: 152,488,791	L62P	probably damaging	Het
Olfr1359	G	A	13: 21,703,068	W22*	probably null	Het
Olfr1359	C	A	13: 21,703,069	L23M	probably damaging	Het
Olfr599	T	G	7: 103,338,320	F89V	probably damaging	Het
Olfr745	T	A	14: 50,642,848	I189N	probably damaging	Het
Pcdh10	A	C	3: 45,392,707	D979A	probably damaging	Het
Pla2g4f	C	G	2: 120,312,325	Q101H	probably benign	Het
Ppp1r15b	T	C	1: 133,133,067	F441L	probably damaging	Het
Prkaca	C	A	8: 83,995,310	P309T	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ripor3	A	G	2: 167,984,466	Y720H	possibly damaging	Het
Rpgrip1	A	G	14: 52,149,351	E751G	possibly damaging	Het
Rsf1	GCGGCGGCGGCGGCGGC	GCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,919		probably benign	Het
Ryr3	A	G	2: 112,900,908	S686P	probably damaging	Het
Seh1l	T	C	18: 67,788,790	V240A	possibly damaging	Het
Slc10a2	T	G	8: 5,089,126	I273L	possibly damaging	Het
Slc23a2	A	T	2: 132,091,217	L107*	probably null	Het
Slc44a4	T	C	17: 34,917,347	L38P	probably damaging	Het
Slc6a18	C	T	13: 73,667,029	V387I	probably benign	Het
Slu7	G	A	11: 43,443,391	A415T	probably benign	Het
Tlr5	A	T	1: 182,974,848	R572S	possibly damaging	Het
Tmem45a2	C	T	16: 57,071,024	G3D	probably benign	Het
Trim24	A	G	6: 37,915,257	T242A	probably damaging	Het
Triobp	T	A	15: 78,973,671	N1157K	probably benign	Het
Ugt1a6a	A	T	1: 88,139,177	D235V	probably benign	Het
Vmn2r37	C	T	7: 9,215,985	V467I	probably benign	Het
Vmn2r7	C	T	3: 64,692,993	E495K	probably benign	Het
Vstm2a	A	G	11: 16,263,098	E161G	probably damaging	Het
Ypel3	T	C	7: 126,778,365	V74A	possibly damaging	Het
Zfp27	C	T	7: 29,895,367	R391H	possibly damaging	Het

Other mutations in Capn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Capn13	APN	17	73339425	missense	possibly damaging	0.82
IGL01099:Capn13	APN	17	73351509	missense	probably damaging	0.99
IGL01613:Capn13	APN	17	73331058	missense	probably benign	0.07
IGL02215:Capn13	APN	17	73330998	missense	probably damaging	1.00
IGL02403:Capn13	APN	17	73351426	missense	possibly damaging	0.82
IGL02877:Capn13	APN	17	73322055	missense	probably damaging	0.97
IGL03113:Capn13	APN	17	73331113	missense	probably benign	0.00
IGL03246:Capn13	APN	17	73382860	missense	probably benign
IGL03369:Capn13	APN	17	73341154	splice site	probably benign
R0116:Capn13	UTSW	17	73351524	missense	probably damaging	1.00
R0729:Capn13	UTSW	17	73322069	missense	probably damaging	1.00
R0745:Capn13	UTSW	17	73351508	missense	probably benign	0.39
R0746:Capn13	UTSW	17	73351508	missense	probably benign	0.39
R0778:Capn13	UTSW	17	73351508	missense	probably benign	0.39
R1252:Capn13	UTSW	17	73367227	missense	possibly damaging	0.80
R1594:Capn13	UTSW	17	73351479	missense	probably benign	0.15
R1641:Capn13	UTSW	17	73382894	missense	possibly damaging	0.91
R1895:Capn13	UTSW	17	73350525	missense	possibly damaging	0.50
R1902:Capn13	UTSW	17	73326361	missense	probably damaging	1.00
R1946:Capn13	UTSW	17	73350525	missense	possibly damaging	0.50
R2184:Capn13	UTSW	17	73365948	missense	probably damaging	1.00
R2427:Capn13	UTSW	17	73326317	splice site	probably benign
R2963:Capn13	UTSW	17	73315263	critical splice donor site	probably null
R3755:Capn13	UTSW	17	73331119	nonsense	probably null
R3759:Capn13	UTSW	17	73322077	missense	probably benign	0.01
R3795:Capn13	UTSW	17	73337392	missense	probably benign	0.14
R3801:Capn13	UTSW	17	73339401	missense	probably benign	0.00
R3802:Capn13	UTSW	17	73339401	missense	probably benign	0.00
R3803:Capn13	UTSW	17	73339401	missense	probably benign	0.00
R3804:Capn13	UTSW	17	73339401	missense	probably benign	0.00
R4194:Capn13	UTSW	17	73339484	missense	possibly damaging	0.48
R4326:Capn13	UTSW	17	73331108	missense	probably benign
R4788:Capn13	UTSW	17	73337432	nonsense	probably null
R4852:Capn13	UTSW	17	73351506	frame shift	probably null
R4853:Capn13	UTSW	17	73351506	frame shift	probably null
R4855:Capn13	UTSW	17	73351506	frame shift	probably null
R5063:Capn13	UTSW	17	73322079	nonsense	probably null
R5112:Capn13	UTSW	17	73351506	frame shift	probably null
R5438:Capn13	UTSW	17	73326484	missense	probably benign
R5955:Capn13	UTSW	17	73331002	missense	possibly damaging	0.92
R6408:Capn13	UTSW	17	73365959	nonsense	probably null
R6512:Capn13	UTSW	17	73382990	missense	probably benign	0.44
R7425:Capn13	UTSW	17	73318058	missense	probably benign	0.13
R7605:Capn13	UTSW	17	73345137	critical splice donor site	probably null
R7678:Capn13	UTSW	17	73315305	missense	probably damaging	1.00
R7776:Capn13	UTSW	17	73322054	missense	probably benign	0.07
R7791:Capn13	UTSW	17	73382888	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TTCCAGTTTGGCCAGTGTC -3'
(R):5'- TTTAAGAGGAAGAGACTGAGGCTTC -3'

Sequencing Primer
(F):5'- AGTGTCTCTACCTAGCCCAAAGTG -3'
(R):5'- ACTGAGGCTTCAAATGTAAAGAAC -3'

Posted On

2015-05-15