Incidental Mutation 'R4084:Capn13'
ID317057
Institutional Source Beutler Lab
Gene Symbol Capn13
Ensembl Gene ENSMUSG00000043705
Gene Namecalpain 13
SynonymsLOC381122
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location73306464-73399296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73337449 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 362 (G362R)
Ref Sequence ENSEMBL: ENSMUSP00000092832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095208]
Predicted Effect probably benign
Transcript: ENSMUST00000095208
AA Change: G362R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: G362R

DomainStartEndE-ValueType
CysPc 12 337 3.23e-113 SMART
Pfam:Calpain_III 341 473 2e-13 PFAM
SCOP:d1k94a_ 512 664 3e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Capn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Capn13 APN 17 73339425 missense possibly damaging 0.82
IGL01099:Capn13 APN 17 73351509 missense probably damaging 0.99
IGL01613:Capn13 APN 17 73331058 missense probably benign 0.07
IGL02215:Capn13 APN 17 73330998 missense probably damaging 1.00
IGL02403:Capn13 APN 17 73351426 missense possibly damaging 0.82
IGL02877:Capn13 APN 17 73322055 missense probably damaging 0.97
IGL03113:Capn13 APN 17 73331113 missense probably benign 0.00
IGL03246:Capn13 APN 17 73382860 missense probably benign
IGL03369:Capn13 APN 17 73341154 splice site probably benign
R0116:Capn13 UTSW 17 73351524 missense probably damaging 1.00
R0729:Capn13 UTSW 17 73322069 missense probably damaging 1.00
R0745:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0746:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0778:Capn13 UTSW 17 73351508 missense probably benign 0.39
R1252:Capn13 UTSW 17 73367227 missense possibly damaging 0.80
R1594:Capn13 UTSW 17 73351479 missense probably benign 0.15
R1641:Capn13 UTSW 17 73382894 missense possibly damaging 0.91
R1895:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R1902:Capn13 UTSW 17 73326361 missense probably damaging 1.00
R1946:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R2184:Capn13 UTSW 17 73365948 missense probably damaging 1.00
R2427:Capn13 UTSW 17 73326317 splice site probably benign
R2963:Capn13 UTSW 17 73315263 critical splice donor site probably null
R3755:Capn13 UTSW 17 73331119 nonsense probably null
R3759:Capn13 UTSW 17 73322077 missense probably benign 0.01
R3795:Capn13 UTSW 17 73337392 missense probably benign 0.14
R3801:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3802:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3803:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3804:Capn13 UTSW 17 73339401 missense probably benign 0.00
R4194:Capn13 UTSW 17 73339484 missense possibly damaging 0.48
R4326:Capn13 UTSW 17 73331108 missense probably benign
R4788:Capn13 UTSW 17 73337432 nonsense probably null
R4852:Capn13 UTSW 17 73351506 frame shift probably null
R4853:Capn13 UTSW 17 73351506 frame shift probably null
R4855:Capn13 UTSW 17 73351506 frame shift probably null
R5063:Capn13 UTSW 17 73322079 nonsense probably null
R5112:Capn13 UTSW 17 73351506 frame shift probably null
R5438:Capn13 UTSW 17 73326484 missense probably benign
R5955:Capn13 UTSW 17 73331002 missense possibly damaging 0.92
R6408:Capn13 UTSW 17 73365959 nonsense probably null
R6512:Capn13 UTSW 17 73382990 missense probably benign 0.44
R7425:Capn13 UTSW 17 73318058 missense probably benign 0.13
R7605:Capn13 UTSW 17 73345137 critical splice donor site probably null
R7678:Capn13 UTSW 17 73315305 missense probably damaging 1.00
R7776:Capn13 UTSW 17 73322054 missense probably benign 0.07
R7791:Capn13 UTSW 17 73382888 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCAGTTTGGCCAGTGTC -3'
(R):5'- TTTAAGAGGAAGAGACTGAGGCTTC -3'

Sequencing Primer
(F):5'- AGTGTCTCTACCTAGCCCAAAGTG -3'
(R):5'- ACTGAGGCTTCAAATGTAAAGAAC -3'
Posted On2015-05-15