Incidental Mutation 'R4084:Lipn'
ID 317060
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 040857-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4084 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 34044758-34062318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34056340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 229 (F229L)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably benign
Transcript: ENSMUST00000025682
AA Change: F229L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: F229L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,601,884 (GRCm39) probably null Het
Arhgdig T C 17: 26,418,799 (GRCm39) D114G possibly damaging Het
Btnl1 C T 17: 34,600,133 (GRCm39) T212I possibly damaging Het
Camkk1 C T 11: 72,928,691 (GRCm39) T410I probably damaging Het
Capn13 C T 17: 73,644,444 (GRCm39) G362R probably benign Het
Catsperd A G 17: 56,961,453 (GRCm39) T392A probably benign Het
Ccdc180 A G 4: 45,950,632 (GRCm39) I1626V probably benign Het
Cdon C A 9: 35,389,427 (GRCm39) T844K probably damaging Het
Col28a1 G A 6: 8,013,131 (GRCm39) Q974* probably null Het
Col28a1 C G 6: 8,013,132 (GRCm39) K973N possibly damaging Het
Dnhd1 T C 7: 105,358,795 (GRCm39) L3428P probably damaging Het
Ecm1 A T 3: 95,641,676 (GRCm39) N519K probably damaging Het
Fbxw11 T C 11: 32,689,248 (GRCm39) V457A probably damaging Het
Flna C T X: 73,280,531 (GRCm39) V1009M possibly damaging Het
Fmnl2 A T 2: 52,997,507 (GRCm39) K486I possibly damaging Het
Gja1 A C 10: 56,264,607 (GRCm39) Q322P possibly damaging Het
Gtpbp3 A G 8: 71,943,156 (GRCm39) Q189R probably benign Het
H2-Eb1 T C 17: 34,533,417 (GRCm39) V213A probably damaging Het
Herc4 G T 10: 63,119,016 (GRCm39) G322V probably damaging Het
Hgf G T 5: 16,820,856 (GRCm39) G668* probably null Het
Htra1 T C 7: 130,538,074 (GRCm39) S25P probably benign Het
Ifi44 A G 3: 151,451,126 (GRCm39) probably null Het
Klhl24 T A 16: 19,933,312 (GRCm39) S308T probably damaging Het
Lamb2 A G 9: 108,365,217 (GRCm39) N1291S probably benign Het
Lgals9 A T 11: 78,860,589 (GRCm39) F162Y possibly damaging Het
Lig3 T A 11: 82,686,250 (GRCm39) I634N probably damaging Het
Lmtk3 T A 7: 45,442,716 (GRCm39) S466R probably damaging Het
Lonrf2 G A 1: 38,860,232 (GRCm39) T22I probably benign Het
Macf1 T C 4: 123,343,865 (GRCm39) H2119R probably damaging Het
Muc6 C T 7: 141,234,920 (GRCm39) C634Y probably damaging Het
Nap1l1 G A 10: 111,325,938 (GRCm39) V86I possibly damaging Het
Noxred1 A G 12: 87,280,258 (GRCm39) Y25H possibly damaging Het
Nphp4 T C 4: 152,573,248 (GRCm39) L62P probably damaging Het
Or11h6 T A 14: 50,880,305 (GRCm39) I189N probably damaging Het
Or2b2 G A 13: 21,887,238 (GRCm39) W22* probably null Het
Or2b2 C A 13: 21,887,239 (GRCm39) L23M probably damaging Het
Or52ab4 T G 7: 102,987,527 (GRCm39) F89V probably damaging Het
Pcdh10 A C 3: 45,347,142 (GRCm39) D979A probably damaging Het
Pla2g4f C G 2: 120,142,806 (GRCm39) Q101H probably benign Het
Ppp1r15b T C 1: 133,060,805 (GRCm39) F441L probably damaging Het
Prkaca C A 8: 84,721,939 (GRCm39) P309T probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ripor3 A G 2: 167,826,386 (GRCm39) Y720H possibly damaging Het
Rpgrip1 A G 14: 52,386,808 (GRCm39) E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,229,126 (GRCm39) probably benign Het
Ryr3 A G 2: 112,731,253 (GRCm39) S686P probably damaging Het
Seh1l T C 18: 67,921,860 (GRCm39) V240A possibly damaging Het
Slc10a2 T G 8: 5,139,126 (GRCm39) I273L possibly damaging Het
Slc23a2 A T 2: 131,933,137 (GRCm39) L107* probably null Het
Slc44a4 T C 17: 35,136,323 (GRCm39) L38P probably damaging Het
Slc6a18 C T 13: 73,815,148 (GRCm39) V387I probably benign Het
Slu7 G A 11: 43,334,218 (GRCm39) A415T probably benign Het
Tlr5 A T 1: 182,802,413 (GRCm39) R572S possibly damaging Het
Tmem45a2 C T 16: 56,891,387 (GRCm39) G3D probably benign Het
Trim24 A G 6: 37,892,192 (GRCm39) T242A probably damaging Het
Triobp T A 15: 78,857,871 (GRCm39) N1157K probably benign Het
Ugt1a6a A T 1: 88,066,899 (GRCm39) D235V probably benign Het
Vmn2r37 C T 7: 9,218,984 (GRCm39) V467I probably benign Het
Vmn2r7 C T 3: 64,600,414 (GRCm39) E495K probably benign Het
Vstm2a A G 11: 16,213,098 (GRCm39) E161G probably damaging Het
Ypel3 T C 7: 126,377,537 (GRCm39) V74A possibly damaging Het
Zfp1005 T A 2: 150,108,122 (GRCm39) N27K possibly damaging Het
Zfp27 C T 7: 29,594,792 (GRCm39) R391H possibly damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34,056,435 (GRCm39) missense probably benign 0.06
IGL01320:Lipn APN 19 34,062,040 (GRCm39) missense probably benign 0.07
IGL01827:Lipn APN 19 34,046,880 (GRCm39) missense probably damaging 1.00
IGL02252:Lipn APN 19 34,049,157 (GRCm39) missense probably benign 0.01
IGL02422:Lipn APN 19 34,046,063 (GRCm39) missense probably benign 0.00
R0081:Lipn UTSW 19 34,054,376 (GRCm39) missense probably benign 0.00
R0284:Lipn UTSW 19 34,058,106 (GRCm39) missense possibly damaging 0.87
R0539:Lipn UTSW 19 34,062,003 (GRCm39) unclassified probably benign
R0749:Lipn UTSW 19 34,054,379 (GRCm39) missense probably damaging 1.00
R1170:Lipn UTSW 19 34,049,158 (GRCm39) missense probably benign 0.23
R1528:Lipn UTSW 19 34,046,070 (GRCm39) missense probably damaging 0.96
R1621:Lipn UTSW 19 34,046,113 (GRCm39) missense probably benign
R1675:Lipn UTSW 19 34,058,110 (GRCm39) missense probably damaging 1.00
R1869:Lipn UTSW 19 34,058,139 (GRCm39) missense possibly damaging 0.93
R3236:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3237:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3832:Lipn UTSW 19 34,046,933 (GRCm39) critical splice donor site probably null
R3876:Lipn UTSW 19 34,046,828 (GRCm39) missense probably benign 0.00
R4595:Lipn UTSW 19 34,058,750 (GRCm39) missense probably damaging 1.00
R5963:Lipn UTSW 19 34,058,700 (GRCm39) missense probably damaging 0.97
R6018:Lipn UTSW 19 34,054,335 (GRCm39) missense probably damaging 1.00
R6797:Lipn UTSW 19 34,058,160 (GRCm39) missense probably benign
R7090:Lipn UTSW 19 34,049,180 (GRCm39) missense possibly damaging 0.72
R7157:Lipn UTSW 19 34,054,390 (GRCm39) nonsense probably null
R7458:Lipn UTSW 19 34,049,242 (GRCm39) missense probably benign 0.10
R8824:Lipn UTSW 19 34,062,116 (GRCm39) missense probably benign 0.04
R8894:Lipn UTSW 19 34,062,248 (GRCm39) makesense probably null
R8933:Lipn UTSW 19 34,046,880 (GRCm39) missense probably damaging 0.98
R9054:Lipn UTSW 19 34,054,376 (GRCm39) missense possibly damaging 0.56
R9117:Lipn UTSW 19 34,046,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGAAGTGAACTTGGAGTC -3'
(R):5'- CTTTCATGCATATCAAATGTCTGCC -3'

Sequencing Primer
(F):5'- GTGAACTTGGAGTCACAGATTTC -3'
(R):5'- CCATTAAGGGCTTATAACACCTATGC -3'
Posted On 2015-05-15