Incidental Mutation 'R4085:Fam20b'
ID317063
Institutional Source Beutler Lab
Gene Symbol Fam20b
Ensembl Gene ENSMUSG00000033557
Gene Namefamily with sequence similarity 20, member B
SynonymsC530043G21Rik
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156678532-156719086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156705875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 57 (D57G)
Ref Sequence ENSEMBL: ENSMUSP00000112534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086153] [ENSMUST00000122424]
Predicted Effect probably benign
Transcript: ENSMUST00000086153
AA Change: D57G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557
AA Change: D57G

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122424
AA Change: D57G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557
AA Change: D57G

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188941
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with decreased embryo size, multisystem organ hypoplasia, and delayed skeleton, digestive system, eye, liver, and lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Fam20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Fam20b APN 1 156702465 missense probably benign 0.13
Cancelled UTSW 1 156705837 missense probably damaging 1.00
consequences UTSW 1 156690553 missense probably damaging 1.00
delisted UTSW 1 156690645 missense probably benign 0.18
Head_over_heels UTSW 1 156690570 missense probably damaging 1.00
minuscule UTSW 1 156705740 missense probably damaging 1.00
squirt UTSW 1 156705729 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0389:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0443:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0518:Fam20b UTSW 1 156687456 missense possibly damaging 0.70
R1466:Fam20b UTSW 1 156686188 splice site probably benign
R1584:Fam20b UTSW 1 156686188 splice site probably benign
R2014:Fam20b UTSW 1 156705941 missense possibly damaging 0.92
R4755:Fam20b UTSW 1 156687496 nonsense probably null
R5254:Fam20b UTSW 1 156705740 missense probably damaging 1.00
R5471:Fam20b UTSW 1 156705729 missense probably damaging 1.00
R6886:Fam20b UTSW 1 156690511 missense probably damaging 1.00
R6944:Fam20b UTSW 1 156687521 missense probably benign 0.02
R7013:Fam20b UTSW 1 156690565 missense probably damaging 1.00
R7205:Fam20b UTSW 1 156702398 critical splice donor site probably null
R7215:Fam20b UTSW 1 156690553 missense probably damaging 1.00
R7286:Fam20b UTSW 1 156681442 missense probably benign 0.28
R7684:Fam20b UTSW 1 156690645 missense probably benign 0.18
R8036:Fam20b UTSW 1 156705837 missense probably damaging 1.00
R8119:Fam20b UTSW 1 156690502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGATGAAGACTCACCGCTTAG -3'
(R):5'- CCACCATGAAGCTGAAGCAG -3'

Sequencing Primer
(F):5'- TGAAGACTCACCGCTTAGGCTTAAAG -3'
(R):5'- CTGAAGCAGCGAGTTGTGC -3'
Posted On2015-05-15