Incidental Mutation 'R4085:Kdm1a'
ID317073
Institutional Source Beutler Lab
Gene Symbol Kdm1a
Ensembl Gene ENSMUSG00000036940
Gene Namelysine (K)-specific demethylase 1A
SynonymsAof2, 1810043O07Rik, Kdm1, LSD1
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136550540-136602723 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 136551962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 762 (Y762*)
Ref Sequence ENSEMBL: ENSMUSP00000111977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000105847] [ENSMUST00000105849] [ENSMUST00000116273] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably benign
Transcript: ENSMUST00000001116
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000046846
AA Change: Y591*
SMART Domains Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940
AA Change: Y591*

DomainStartEndE-ValueType
low complexity region 47 80 N/A INTRINSIC
Pfam:SWIRM 85 173 1.1e-20 PFAM
Pfam:AlaDh_PNT_C 181 297 8.4e-8 PFAM
Pfam:FAD_binding_2 189 236 1.6e-6 PFAM
Pfam:Pyr_redox 189 237 6.5e-7 PFAM
Pfam:DAO 189 457 1.5e-9 PFAM
Pfam:NAD_binding_8 192 256 9e-16 PFAM
Pfam:Amino_oxidase 197 657 7e-133 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105847
AA Change: Y782*
SMART Domains Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940
AA Change: Y782*

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
Pfam:SWIRM 197 285 8.8e-21 PFAM
Pfam:FAD_binding_2 301 348 6e-6 PFAM
Pfam:Pyr_redox 301 349 3e-6 PFAM
Pfam:DAO 301 557 9.9e-9 PFAM
Pfam:NAD_binding_8 304 368 4e-15 PFAM
Pfam:Amino_oxidase 309 847 2e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105849
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000116273
AA Change: Y762*
SMART Domains Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940
AA Change: Y762*

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
Pfam:SWIRM 175 265 2.7e-21 PFAM
Pfam:Pyr_redox 281 327 5.5e-7 PFAM
Pfam:FAD_binding_2 281 328 5.3e-6 PFAM
Pfam:DAO 281 403 3.7e-8 PFAM
Pfam:NAD_binding_8 284 348 5.7e-16 PFAM
Pfam:Amino_oxidase 289 827 9.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147886
Predicted Effect probably benign
Transcript: ENSMUST00000155354
SMART Domains Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
Pfam:Amino_oxidase 3 250 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably benign
Transcript: ENSMUST00000170102
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171424
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Kdm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Kdm1a APN 4 136554247 missense probably damaging 1.00
IGL01106:Kdm1a APN 4 136572328 splice site probably benign
IGL01356:Kdm1a APN 4 136553891 missense probably damaging 1.00
IGL01886:Kdm1a APN 4 136561016 critical splice donor site probably null
IGL02605:Kdm1a APN 4 136551037 unclassified probably benign
IGL02885:Kdm1a APN 4 136552535 missense probably benign 0.00
Seven_falls UTSW 4 136568600 nonsense probably null
R0095:Kdm1a UTSW 4 136550894 missense probably benign 0.09
R0532:Kdm1a UTSW 4 136561066 missense probably damaging 1.00
R0553:Kdm1a UTSW 4 136555298 missense probably damaging 1.00
R3625:Kdm1a UTSW 4 136561108 missense possibly damaging 0.93
R4285:Kdm1a UTSW 4 136582036 splice site probably null
R5118:Kdm1a UTSW 4 136557358 unclassified probably benign
R5493:Kdm1a UTSW 4 136557421 frame shift probably null
R5800:Kdm1a UTSW 4 136573070 splice site probably null
R5945:Kdm1a UTSW 4 136568701 splice site probably null
R6256:Kdm1a UTSW 4 136568600 nonsense probably null
R6508:Kdm1a UTSW 4 136554310 missense probably damaging 1.00
R7243:Kdm1a UTSW 4 136551954 missense probably damaging 1.00
R7270:Kdm1a UTSW 4 136552527 missense probably damaging 0.97
R7723:Kdm1a UTSW 4 136557749 missense probably benign 0.06
R8391:Kdm1a UTSW 4 136553843 missense probably benign 0.45
X0066:Kdm1a UTSW 4 136559225 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGCTACATTTACAAAGCTCATG -3'
(R):5'- CCCCTATGAAAGAGTAAGCAACATG -3'

Sequencing Primer
(F):5'- TCCCCAAATAGGCTCAGA -3'
(R):5'- GAGTAAGCAACATGGTTCTTCTCAC -3'
Posted On2015-05-15