Incidental Mutation 'R4085:Fndc4'
ID317076
Institutional Source Beutler Lab
Gene Symbol Fndc4
Ensembl Gene ENSMUSG00000038552
Gene Namefibronectin type III domain containing 4
SynonymsFRCP1, 2810430J06Rik, 6330410H20Rik
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31292242-31296080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31293777 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 190 (I190T)
Ref Sequence ENSEMBL: ENSMUSP00000144195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041266] [ENSMUST00000041565] [ENSMUST00000072228] [ENSMUST00000172435] [ENSMUST00000201166] [ENSMUST00000201417] [ENSMUST00000201675] [ENSMUST00000201809] [ENSMUST00000202615] [ENSMUST00000202158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041266
AA Change: I190T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047185
Gene: ENSMUSG00000038552
AA Change: I190T

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041565
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000172435
AA Change: I190T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127404
Gene: ENSMUSG00000038552
AA Change: I190T

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200845
Predicted Effect probably benign
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201274
Predicted Effect probably benign
Transcript: ENSMUST00000201417
SMART Domains Protein: ENSMUSP00000144142
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
FN3 43 118 9.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201675
SMART Domains Protein: ENSMUSP00000144568
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 120 7e-64 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201809
SMART Domains Protein: ENSMUSP00000144425
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 3.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201906
Predicted Effect probably damaging
Transcript: ENSMUST00000202615
AA Change: I190T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144195
Gene: ENSMUSG00000038552
AA Change: I190T

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
FN3 43 123 2.2e-13 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202909
Predicted Effect probably benign
Transcript: ENSMUST00000202158
Meta Mutation Damage Score 0.6262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygous knockout mice suffer from increased severity of DSS-induced colitis with increased weight loss and decreased colon length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Fndc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Fndc4 APN 5 31293496 unclassified probably benign
IGL01963:Fndc4 APN 5 31295212 critical splice donor site probably null
IGL02507:Fndc4 APN 5 31294746 missense probably damaging 1.00
IGL02702:Fndc4 APN 5 31293735 missense probably damaging 1.00
IGL02748:Fndc4 APN 5 31294786 missense possibly damaging 0.95
R1489:Fndc4 UTSW 5 31293451 makesense probably null
R5418:Fndc4 UTSW 5 31294634 missense probably benign 0.25
R7055:Fndc4 UTSW 5 31294178 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACATTCCATGCACACAGTG -3'
(R):5'- AATCGGGACAACTTCGAGGG -3'

Sequencing Primer
(F):5'- TTCCATGCACACAGTGTACAC -3'
(R):5'- GGGGAGAGAGGCTTCTGC -3'
Posted On2015-05-15