Incidental Mutation 'R4085:Opn1sw'
ID317080
Institutional Source Beutler Lab
Gene Symbol Opn1sw
Ensembl Gene ENSMUSG00000058831
Gene Nameopsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
SynonymsBlue/UV Opsin, Bcp, UV cone pigment, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29376671-29388468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29380144 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 91 (I91T)
Ref Sequence ENSEMBL: ENSMUSP00000133745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031779] [ENSMUST00000080428] [ENSMUST00000090481] [ENSMUST00000147483] [ENSMUST00000172974] [ENSMUST00000173653]
Predicted Effect probably benign
Transcript: ENSMUST00000031779
SMART Domains Protein: ENSMUSP00000031779
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 3e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080428
AA Change: I91T

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079289
Gene: ENSMUSG00000058831
AA Change: I91T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 41 318 4e-9 PFAM
Pfam:7tm_1 49 301 2.5e-43 PFAM
Pfam:7tm_4 188 319 6.2e-8 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090481
SMART Domains Protein: ENSMUSP00000087967
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.82e0 SMART
EFh 108 136 2.44e1 SMART
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131928
Predicted Effect possibly damaging
Transcript: ENSMUST00000147483
AA Change: I91T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133745
Gene: ENSMUSG00000058831
AA Change: I91T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 250 9.2e-7 PFAM
Pfam:7TM_GPCR_Srv 41 254 1.8e-6 PFAM
Pfam:7tm_1 49 271 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172607
SMART Domains Protein: ENSMUSP00000133609
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
Blast:EFh 2 20 1e-5 BLAST
SCOP:d2mysb_ 2 51 6e-5 SMART
Blast:EFh 28 56 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172974
SMART Domains Protein: ENSMUSP00000133390
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 1e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 1.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173653
SMART Domains Protein: ENSMUSP00000133534
Gene: ENSMUSG00000058831

DomainStartEndE-ValueType
Pfam:7tm_1 1 61 6.6e-7 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal cone physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Opn1sw
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Opn1sw APN 6 29379804 missense possibly damaging 0.88
R0550:Opn1sw UTSW 6 29380204 missense probably damaging 1.00
R1533:Opn1sw UTSW 6 29378924 missense probably benign 0.36
R1902:Opn1sw UTSW 6 29379804 missense possibly damaging 0.88
R4418:Opn1sw UTSW 6 29379424 nonsense probably null
R4812:Opn1sw UTSW 6 29378039 missense probably damaging 0.99
R5692:Opn1sw UTSW 6 29379841 unclassified probably benign
R5839:Opn1sw UTSW 6 29379830 missense probably damaging 1.00
R5915:Opn1sw UTSW 6 29379755 splice site probably null
R6045:Opn1sw UTSW 6 29379870 missense probably damaging 1.00
R6295:Opn1sw UTSW 6 29379414 missense possibly damaging 0.90
R6784:Opn1sw UTSW 6 29379847 missense probably damaging 1.00
R7259:Opn1sw UTSW 6 29378912 missense probably benign
R7315:Opn1sw UTSW 6 29379363 missense probably damaging 1.00
R7412:Opn1sw UTSW 6 29379857 missense probably damaging 1.00
R7749:Opn1sw UTSW 6 29380169 missense probably benign 0.00
Z1176:Opn1sw UTSW 6 29379456 missense probably damaging 1.00
Z1177:Opn1sw UTSW 6 29380344 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATGGGGTAGACAGACTCCC -3'
(R):5'- AGGCAGCCTTCATGGGATTTG -3'

Sequencing Primer
(F):5'- TCCCTGAGCCTGGAGTGGAATATAG -3'
(R):5'- GCAGCCTTCATGGGATTTGTCTTC -3'
Posted On2015-05-15