Incidental Mutation 'R4085:Taok2'
ID317086
Institutional Source Beutler Lab
Gene Symbol Taok2
Ensembl Gene ENSMUSG00000059981
Gene NameTAO kinase 2
SynonymsMAP3K17, TAO2, 1110033K02Rik, PSK1, TAO1
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126865678-126884703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126874725 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 403 (E403G)
Ref Sequence ENSEMBL: ENSMUSP00000112963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071268] [ENSMUST00000117394] [ENSMUST00000214525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071268
AA Change: E403G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981
AA Change: E403G

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117394
AA Change: E403G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112963
Gene: ENSMUSG00000059981
AA Change: E403G

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
transmembrane domain 962 984 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1017 1039 N/A INTRINSIC
transmembrane domain 1052 1074 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1197 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. Mice homozygous for a targeted allele exhibit resistance to the ataxic effect of alcohol, reduced blood ethanol content, increased alcohol consumption, impaired CPP for alcohol, and impaired habituation in an open field. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Taok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Taok2 APN 7 126872411 missense probably damaging 0.98
IGL01153:Taok2 APN 7 126871032 missense probably damaging 0.99
IGL02689:Taok2 APN 7 126876098 missense probably damaging 0.99
R0049:Taok2 UTSW 7 126866411 missense possibly damaging 0.92
R0601:Taok2 UTSW 7 126879433 missense probably damaging 1.00
R0976:Taok2 UTSW 7 126875151 missense possibly damaging 0.77
R1456:Taok2 UTSW 7 126880141 missense probably benign 0.09
R1643:Taok2 UTSW 7 126875938 unclassified probably benign
R2084:Taok2 UTSW 7 126870191 missense probably benign 0.04
R2212:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R2471:Taok2 UTSW 7 126875100 missense probably damaging 0.98
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3412:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R4440:Taok2 UTSW 7 126866521 missense possibly damaging 0.85
R4775:Taok2 UTSW 7 126870768 missense probably damaging 0.99
R4787:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4788:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4791:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4927:Taok2 UTSW 7 126876041 missense probably damaging 1.00
R5651:Taok2 UTSW 7 126880283 missense probably damaging 1.00
R6371:Taok2 UTSW 7 126870147 missense probably damaging 1.00
R6408:Taok2 UTSW 7 126870992 missense probably benign
R6605:Taok2 UTSW 7 126878758 missense probably damaging 1.00
R6828:Taok2 UTSW 7 126871875 splice site probably null
R6863:Taok2 UTSW 7 126871937 missense probably damaging 0.99
R6962:Taok2 UTSW 7 126866916 critical splice acceptor site probably null
R6967:Taok2 UTSW 7 126870392 missense probably damaging 0.98
R7127:Taok2 UTSW 7 126867154 missense possibly damaging 0.82
R7187:Taok2 UTSW 7 126872380 missense probably damaging 0.99
R7307:Taok2 UTSW 7 126866818 missense probably damaging 1.00
R7325:Taok2 UTSW 7 126871088 missense probably benign
R7429:Taok2 UTSW 7 126870677 missense possibly damaging 0.95
R7497:Taok2 UTSW 7 126874878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCAGACTAAAAGGAGGAGC -3'
(R):5'- AAGGGCTTGGTCCTTCTTCC -3'

Sequencing Primer
(F):5'- CAGACACCTAGAGAGCAGGAAC -3'
(R):5'- TGTTCCCAGGAGGCAGAAC -3'
Posted On2015-05-15