Incidental Mutation 'R4085:Ucp1'
ID317087
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Nameuncoupling protein 1 (mitochondrial, proton carrier)
SynonymsSlc25a7
MMRRC Submission 040979-MU
Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83290352-83298452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83293951 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 130 (I130T)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
Predicted Effect probably benign
Transcript: ENSMUST00000034146
AA Change: I130T

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: I130T

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Meta Mutation Damage Score 0.2354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 83293948 missense probably damaging 1.00
R0050:Ucp1 UTSW 8 83294228 missense probably damaging 1.00
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0505:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 83291603 splice site probably benign
R0681:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 83297847 splice site probably benign
R1606:Ucp1 UTSW 8 83295304 missense probably damaging 1.00
R1722:Ucp1 UTSW 8 83290688 missense probably benign 0.25
R1809:Ucp1 UTSW 8 83297867 missense probably damaging 0.99
R1823:Ucp1 UTSW 8 83294032 missense probably damaging 1.00
R3809:Ucp1 UTSW 8 83290641 missense probably damaging 0.99
R4673:Ucp1 UTSW 8 83295247 missense probably damaging 1.00
R4998:Ucp1 UTSW 8 83297855 critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 83294203 missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 83290691 missense probably benign 0.12
R5790:Ucp1 UTSW 8 83297891 missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 83293938 missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 83294089 critical splice donor site probably null
R6732:Ucp1 UTSW 8 83291477 missense probably benign 0.08
R7282:Ucp1 UTSW 8 83293902 missense probably benign 0.03
R7343:Ucp1 UTSW 8 83295252 missense probably damaging 0.99
R7878:Ucp1 UTSW 8 83297892 missense probably benign 0.19
R7961:Ucp1 UTSW 8 83297892 missense probably benign 0.19
R8008:Ucp1 UTSW 8 83294011 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGAGTTTGTCCTCTGTGCACC -3'
(R):5'- ACTGTGGCTGTTCACTTGGC -3'

Sequencing Primer
(F):5'- GTCCTCTGTGCACCCACTAC -3'
(R):5'- GGCAGTTAGCTACCTTTCCAAAGTG -3'
Posted On2015-05-15