Incidental Mutation 'R4085:Sall1'
ID317088
Institutional Source Beutler Lab
Gene Symbol Sall1
Ensembl Gene ENSMUSG00000031665
Gene Namespalt like transcription factor 1
SynonymsMsal-3
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location89027235-89044162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89028509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1281 (V1281M)
Ref Sequence ENSEMBL: ENSMUSP00000034090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034090]
Predicted Effect probably benign
Transcript: ENSMUST00000034090
AA Change: V1281M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: V1281M

DomainStartEndE-ValueType
low complexity region 133 152 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 229 257 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
low complexity region 361 396 N/A INTRINSIC
ZnF_C2H2 450 472 2.57e-3 SMART
ZnF_C2H2 478 500 3.21e-4 SMART
low complexity region 547 569 N/A INTRINSIC
ZnF_C2H2 705 727 3.02e0 SMART
ZnF_C2H2 733 755 8.6e-5 SMART
ZnF_C2H2 765 787 1.6e-4 SMART
low complexity region 842 861 N/A INTRINSIC
ZnF_C2H2 1000 1022 2.91e-2 SMART
ZnF_C2H2 1028 1050 4.94e-5 SMART
ZnF_C2H2 1133 1155 1.38e-3 SMART
ZnF_C2H2 1161 1183 1.22e-4 SMART
low complexity region 1257 1277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183771
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Sall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sall1 APN 8 89033344 missense probably damaging 1.00
IGL01670:Sall1 APN 8 89031571 missense probably benign 0.01
IGL01795:Sall1 APN 8 89028680 missense probably benign 0.02
IGL02041:Sall1 APN 8 89031469 missense probably damaging 1.00
IGL02078:Sall1 APN 8 89030375 missense probably damaging 0.99
IGL02105:Sall1 APN 8 89032568 missense probably damaging 0.99
IGL02354:Sall1 APN 8 89033049 missense probably benign 0.10
IGL02727:Sall1 APN 8 89030755 missense probably damaging 1.00
IGL02943:Sall1 APN 8 89031121 missense probably damaging 0.99
IGL03179:Sall1 APN 8 89031661 missense probably benign 0.00
PIT4651001:Sall1 UTSW 8 89031103 missense probably damaging 1.00
R0089:Sall1 UTSW 8 89030268 missense probably benign 0.09
R0386:Sall1 UTSW 8 89032604 missense probably damaging 1.00
R0532:Sall1 UTSW 8 89033191 missense probably benign
R0555:Sall1 UTSW 8 89031758 missense probably benign 0.16
R1203:Sall1 UTSW 8 89031934 missense probably damaging 1.00
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1449:Sall1 UTSW 8 89032483 missense probably benign
R1477:Sall1 UTSW 8 89032882 missense probably damaging 1.00
R1692:Sall1 UTSW 8 89028400 missense probably benign 0.00
R1839:Sall1 UTSW 8 89028716 missense possibly damaging 0.89
R2016:Sall1 UTSW 8 89028409 missense probably benign 0.10
R2041:Sall1 UTSW 8 89032801 missense probably benign
R3808:Sall1 UTSW 8 89031473 nonsense probably null
R3816:Sall1 UTSW 8 89032675 missense probably benign 0.00
R4604:Sall1 UTSW 8 89030341 missense probably damaging 1.00
R4701:Sall1 UTSW 8 89031160 missense probably damaging 1.00
R5760:Sall1 UTSW 8 89028650 missense possibly damaging 0.94
R6091:Sall1 UTSW 8 89028619 missense probably damaging 1.00
R6213:Sall1 UTSW 8 89033058 small deletion probably benign
R6326:Sall1 UTSW 8 89030268 missense probably benign 0.09
R6920:Sall1 UTSW 8 89030393 missense probably damaging 1.00
R6954:Sall1 UTSW 8 89032891 missense probably damaging 1.00
R7395:Sall1 UTSW 8 89030921 missense possibly damaging 0.86
R7396:Sall1 UTSW 8 89032768 missense probably damaging 1.00
R7493:Sall1 UTSW 8 89031053 missense probably benign 0.32
R7555:Sall1 UTSW 8 89033158 missense possibly damaging 0.90
R7672:Sall1 UTSW 8 89031299 missense probably damaging 0.99
R7759:Sall1 UTSW 8 89042351 critical splice donor site probably null
R7834:Sall1 UTSW 8 89033374 missense probably benign 0.42
R8023:Sall1 UTSW 8 89032543 missense probably damaging 0.99
R8166:Sall1 UTSW 8 89028518 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTAGTTCATAGTCCCAGGGG -3'
(R):5'- ATGTTCCAGAAGGATCTAGCGG -3'

Sequencing Primer
(F):5'- CATAGTCCCAGGGGCCAGAAG -3'
(R):5'- ATCTAGCGGCGAGGTCAG -3'
Posted On2015-05-15