Incidental Mutation 'R0391:Ppfia2'
ID31709
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0391 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 106830714 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably benign
Transcript: ENSMUST00000029404
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217854
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106830659 missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106865403 critical splice donor site probably null
R7866:Ppfia2 UTSW 10 106819529 missense probably damaging 0.97
R7897:Ppfia2 UTSW 10 106819538 missense probably damaging 0.99
R7949:Ppfia2 UTSW 10 106819529 missense probably damaging 0.97
R7980:Ppfia2 UTSW 10 106819538 missense probably damaging 0.99
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Z1176:Ppfia2 UTSW 10 106474645 missense probably damaging 0.97
Z1177:Ppfia2 UTSW 10 106906555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGATTTTGAGGCTCCAAGAGCA -3'
(R):5'- TGTGACTGAATGGCTTTCAATGGTACA -3'

Sequencing Primer
(F):5'- AGAGTTCATAGACTTGCTCTAACTCC -3'
(R):5'- TCAGCAACATGATACTTTGCC -3'
Posted On2013-04-24