Incidental Mutation 'R0391:Ppfia2'
ID 31709
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms Liprin-alpha2, E130120L08Rik
MMRRC Submission 038597-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0391 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 106305129-106769329 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 106666575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029404
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217854
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,594,970 (GRCm39) probably benign Het
Abcc2 G A 19: 43,810,044 (GRCm39) probably benign Het
Abcc8 C G 7: 45,771,597 (GRCm39) G838A probably damaging Het
Akr1c21 G A 13: 4,631,199 (GRCm39) A245T probably damaging Het
Anapc15-ps T C 10: 95,509,139 (GRCm39) E47G probably damaging Het
Apoa1 A G 9: 46,141,140 (GRCm39) T79A probably benign Het
Atp6v1b1 A G 6: 83,733,903 (GRCm39) H378R possibly damaging Het
C4b A G 17: 34,954,588 (GRCm39) probably benign Het
Catsperd A T 17: 56,969,821 (GRCm39) E638D probably benign Het
Cckar C T 5: 53,863,595 (GRCm39) probably null Het
Cfap100 C T 6: 90,382,321 (GRCm39) probably benign Het
Chd1 G T 17: 15,970,156 (GRCm39) G970C probably damaging Het
Col14a1 A G 15: 55,309,655 (GRCm39) probably benign Het
Col17a1 C T 19: 47,652,263 (GRCm39) V698M probably damaging Het
Cpeb1 T C 7: 81,011,473 (GRCm39) D156G possibly damaging Het
Cryl1 A G 14: 57,541,232 (GRCm39) Y151H possibly damaging Het
Csmd3 C A 15: 47,520,969 (GRCm39) V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 (GRCm39) A73T probably damaging Het
Cyp2c37 T C 19: 39,982,950 (GRCm39) S180P probably damaging Het
Cyp2c54 T C 19: 40,060,613 (GRCm39) T123A possibly damaging Het
Dennd6b T C 15: 89,071,417 (GRCm39) D304G probably damaging Het
Dnmt3l T C 10: 77,887,750 (GRCm39) probably benign Het
Eci1 G A 17: 24,652,234 (GRCm39) probably null Het
Efhc1 A G 1: 21,030,412 (GRCm39) Y115C probably damaging Het
Ern1 T A 11: 106,298,004 (GRCm39) K706* probably null Het
Ghrl T C 6: 113,696,299 (GRCm39) E31G probably damaging Het
Gpr108 A C 17: 57,550,101 (GRCm39) V179G probably benign Het
Henmt1 A G 3: 108,865,851 (GRCm39) probably benign Het
Ift172 A G 5: 31,444,011 (GRCm39) V69A probably damaging Het
Il17ra T C 6: 120,453,940 (GRCm39) probably benign Het
Il17rb T C 14: 29,726,304 (GRCm39) N95D probably benign Het
Il17rb G T 14: 29,728,112 (GRCm39) probably null Het
Iqub G A 6: 24,446,154 (GRCm39) L757F probably benign Het
Itpr1 T C 6: 108,355,128 (GRCm39) V473A probably benign Het
Itpr2 T G 6: 146,131,271 (GRCm39) N1978H probably damaging Het
Klk1b26 T A 7: 43,662,151 (GRCm39) F3Y probably damaging Het
Lars1 A G 18: 42,384,428 (GRCm39) V50A probably benign Het
Lax1 G T 1: 133,607,804 (GRCm39) H312Q probably benign Het
Lctl T C 9: 64,029,596 (GRCm39) probably benign Het
Lrp2 T A 2: 69,287,202 (GRCm39) D3745V probably damaging Het
Lrp2 G A 2: 69,290,681 (GRCm39) probably benign Het
Lvrn A T 18: 46,983,533 (GRCm39) H92L probably benign Het
Marchf1 A G 8: 66,871,625 (GRCm39) T385A probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mbd5 T C 2: 49,162,428 (GRCm39) V970A possibly damaging Het
Mccc1 A G 3: 36,017,719 (GRCm39) probably benign Het
Mpp4 A T 1: 59,182,988 (GRCm39) probably benign Het
Mrnip G A 11: 50,090,747 (GRCm39) A304T probably damaging Het
Muc5b T C 7: 141,418,819 (GRCm39) S3922P possibly damaging Het
Myh3 T A 11: 66,987,333 (GRCm39) probably benign Het
Nbea A T 3: 55,944,698 (GRCm39) H555Q probably damaging Het
Niban3 T A 8: 72,055,143 (GRCm39) probably benign Het
Nlrp9c A T 7: 26,070,901 (GRCm39) probably benign Het
Nmur1 A T 1: 86,315,400 (GRCm39) V178E probably damaging Het
Nod2 T G 8: 89,390,406 (GRCm39) S238A probably benign Het
Ogfod1 A T 8: 94,789,651 (GRCm39) T451S probably damaging Het
Or1e17 T C 11: 73,831,935 (GRCm39) F288L probably damaging Het
Or2d36 T A 7: 106,747,394 (GRCm39) Y290* probably null Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or8b8 G A 9: 37,809,138 (GRCm39) G146D probably benign Het
Pcdh20 T C 14: 88,706,104 (GRCm39) I399V probably benign Het
Pdlim1 G T 19: 40,232,017 (GRCm39) H120Q probably damaging Het
Plg T C 17: 12,637,968 (GRCm39) V798A probably damaging Het
Polr2c A G 8: 95,584,403 (GRCm39) I39V possibly damaging Het
Ppp1r3a A T 6: 14,719,696 (GRCm39) I406N probably benign Het
Psg28 A T 7: 18,160,098 (GRCm39) M366K probably benign Het
Rad54b T C 4: 11,601,702 (GRCm39) I419T probably damaging Het
Rnf43 A G 11: 87,622,108 (GRCm39) Q403R possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Slc28a3 A G 13: 58,717,229 (GRCm39) probably benign Het
Smad2 A T 18: 76,422,108 (GRCm39) probably null Het
Smad4 G A 18: 73,791,720 (GRCm39) P274S probably benign Het
Smchd1 A T 17: 71,710,149 (GRCm39) V906D probably damaging Het
Soat2 C A 15: 102,067,188 (GRCm39) R320S possibly damaging Het
Spata33 C T 8: 123,948,626 (GRCm39) A57V probably damaging Het
Stab1 A G 14: 30,865,375 (GRCm39) L1814P probably benign Het
Stab2 T C 10: 86,783,008 (GRCm39) K680R probably benign Het
Stil A G 4: 114,898,369 (GRCm39) probably null Het
Sympk T A 7: 18,780,774 (GRCm39) L759H probably benign Het
Tet1 A T 10: 62,650,325 (GRCm39) probably null Het
Tfpi2 A T 6: 3,965,460 (GRCm39) N117K probably benign Het
Tle3 A G 9: 61,323,943 (GRCm39) Y766C probably damaging Het
Trpt1 C A 19: 6,975,298 (GRCm39) probably null Het
Tshz1 A G 18: 84,034,174 (GRCm39) F78S possibly damaging Het
Ttc1 T C 11: 43,629,635 (GRCm39) D177G probably damaging Het
Ttc13 T A 8: 125,401,140 (GRCm39) Y741F probably damaging Het
Ulk3 C T 9: 57,502,115 (GRCm39) S462L probably benign Het
Utrn C T 10: 12,401,077 (GRCm39) probably benign Het
V1rd19 A C 7: 23,703,010 (GRCm39) T159P probably damaging Het
Vars1 T C 17: 35,230,462 (GRCm39) V515A possibly damaging Het
Vmn1r85 A G 7: 12,818,515 (GRCm39) Y210H probably benign Het
Vmn2r89 A G 14: 51,693,435 (GRCm39) T262A probably damaging Het
Vps53 G A 11: 76,012,405 (GRCm39) T209I probably benign Het
Wdfy2 T C 14: 63,162,582 (GRCm39) F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 (GRCm39) S694Y probably damaging Het
Zbtb8b T A 4: 129,326,463 (GRCm39) D201V probably damaging Het
Zmym5 A C 14: 57,041,908 (GRCm39) N123K possibly damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106,655,353 (GRCm39) missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106,694,068 (GRCm39) missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106,749,560 (GRCm39) missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106,671,909 (GRCm39) splice site probably benign
IGL01899:Ppfia2 APN 10 106,751,612 (GRCm39) critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106,740,706 (GRCm39) missense probably null 0.83
IGL02143:Ppfia2 APN 10 106,693,360 (GRCm39) missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106,636,646 (GRCm39) missense probably benign
IGL02565:Ppfia2 APN 10 106,699,247 (GRCm39) critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106,664,789 (GRCm39) missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106,742,255 (GRCm39) missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106,636,637 (GRCm39) missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106,603,348 (GRCm39) missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106,732,368 (GRCm39) missense possibly damaging 0.76
Colorless UTSW 10 106,749,455 (GRCm39) missense probably damaging 1.00
PIT4458001:Ppfia2 UTSW 10 106,763,708 (GRCm39) missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106,678,647 (GRCm39) splice site probably benign
R0018:Ppfia2 UTSW 10 106,678,647 (GRCm39) splice site probably benign
R0323:Ppfia2 UTSW 10 106,732,281 (GRCm39) missense possibly damaging 0.84
R0667:Ppfia2 UTSW 10 106,749,555 (GRCm39) missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106,763,592 (GRCm39) missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106,655,372 (GRCm39) missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106,666,518 (GRCm39) missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106,666,429 (GRCm39) missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106,751,533 (GRCm39) splice site probably null
R1780:Ppfia2 UTSW 10 106,732,368 (GRCm39) missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106,763,571 (GRCm39) missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106,310,538 (GRCm39) missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106,673,160 (GRCm39) missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106,673,190 (GRCm39) missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106,597,972 (GRCm39) missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106,690,841 (GRCm39) missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106,655,351 (GRCm39) missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106,701,268 (GRCm39) splice site probably null
R3113:Ppfia2 UTSW 10 106,742,256 (GRCm39) nonsense probably null
R3968:Ppfia2 UTSW 10 106,742,382 (GRCm39) missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106,701,267 (GRCm39) splice site probably null
R4632:Ppfia2 UTSW 10 106,671,905 (GRCm39) splice site probably null
R4718:Ppfia2 UTSW 10 106,694,146 (GRCm39) missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106,751,551 (GRCm39) missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106,690,818 (GRCm39) missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106,690,818 (GRCm39) missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106,701,224 (GRCm39) nonsense probably null
R5029:Ppfia2 UTSW 10 106,693,304 (GRCm39) missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106,671,621 (GRCm39) missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106,740,708 (GRCm39) critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106,671,562 (GRCm39) missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106,742,338 (GRCm39) missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106,742,338 (GRCm39) missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106,693,430 (GRCm39) missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106,749,455 (GRCm39) missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106,749,559 (GRCm39) missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106,729,361 (GRCm39) missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106,671,586 (GRCm39) missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106,763,633 (GRCm39) missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106,742,319 (GRCm39) nonsense probably null
R6992:Ppfia2 UTSW 10 106,310,715 (GRCm39) missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106,597,970 (GRCm39) missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106,693,356 (GRCm39) missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106,763,691 (GRCm39) missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106,763,687 (GRCm39) missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106,666,520 (GRCm39) missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106,701,264 (GRCm39) critical splice donor site probably null
R7866:Ppfia2 UTSW 10 106,655,390 (GRCm39) missense probably damaging 0.97
R7897:Ppfia2 UTSW 10 106,655,399 (GRCm39) missense probably damaging 0.99
R7937:Ppfia2 UTSW 10 106,699,233 (GRCm39) missense probably benign 0.30
R7938:Ppfia2 UTSW 10 106,310,648 (GRCm39) missense probably damaging 0.97
R8218:Ppfia2 UTSW 10 106,699,236 (GRCm39) missense probably benign 0.07
R8431:Ppfia2 UTSW 10 106,671,952 (GRCm39) nonsense probably null
R8806:Ppfia2 UTSW 10 106,694,114 (GRCm39) missense probably damaging 1.00
R8984:Ppfia2 UTSW 10 106,694,439 (GRCm39) intron probably benign
R9008:Ppfia2 UTSW 10 106,655,220 (GRCm39) missense probably benign 0.00
R9014:Ppfia2 UTSW 10 106,763,666 (GRCm39) missense probably benign 0.05
R9182:Ppfia2 UTSW 10 106,763,640 (GRCm39) missense probably benign 0.39
R9201:Ppfia2 UTSW 10 106,678,640 (GRCm39) critical splice donor site probably null
R9249:Ppfia2 UTSW 10 106,749,429 (GRCm39) missense probably damaging 1.00
R9620:Ppfia2 UTSW 10 106,749,519 (GRCm39) missense
R9710:Ppfia2 UTSW 10 106,664,885 (GRCm39) missense probably benign 0.00
X0021:Ppfia2 UTSW 10 106,310,538 (GRCm39) missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106,729,295 (GRCm39) missense probably damaging 1.00
Z1176:Ppfia2 UTSW 10 106,310,506 (GRCm39) missense probably damaging 0.97
Z1177:Ppfia2 UTSW 10 106,742,416 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGATTTTGAGGCTCCAAGAGCA -3'
(R):5'- TGTGACTGAATGGCTTTCAATGGTACA -3'

Sequencing Primer
(F):5'- AGAGTTCATAGACTTGCTCTAACTCC -3'
(R):5'- TCAGCAACATGATACTTTGCC -3'
Posted On 2013-04-24