Incidental Mutation 'R4085:Kank2'
ID317091
Institutional Source Beutler Lab
Gene Symbol Kank2
Ensembl Gene ENSMUSG00000032194
Gene NameKN motif and ankyrin repeat domains 2
SynonymsAnkrd25
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R4085 (G1)
Quality Score164
Status Validated
Chromosome9
Chromosomal Location21766784-21798744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21795119 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 201 (L201P)
Ref Sequence ENSEMBL: ENSMUSP00000151181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000213691] [ENSMUST00000216008] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034717
AA Change: L201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: L201P

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213691
Predicted Effect probably damaging
Transcript: ENSMUST00000216008
AA Change: L201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217336
Meta Mutation Damage Score 0.2978 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Kank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Kank2 APN 9 21780479 splice site probably benign
IGL01574:Kank2 APN 9 21794604 missense probably damaging 1.00
IGL01624:Kank2 APN 9 21780380 missense probably damaging 1.00
IGL02752:Kank2 APN 9 21795033 missense probably damaging 1.00
IGL03116:Kank2 APN 9 21772764 missense probably damaging 0.96
IGL03133:Kank2 APN 9 21795641 missense probably null 0.82
IGL03384:Kank2 APN 9 21774578 missense possibly damaging 0.82
PIT4515001:Kank2 UTSW 9 21794883 missense probably benign
R0054:Kank2 UTSW 9 21774674 nonsense probably null
R0480:Kank2 UTSW 9 21779899 missense probably damaging 1.00
R1270:Kank2 UTSW 9 21772760 missense probably damaging 1.00
R1538:Kank2 UTSW 9 21774631 missense probably damaging 0.99
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1602:Kank2 UTSW 9 21769837 missense probably damaging 1.00
R1827:Kank2 UTSW 9 21795465 missense probably damaging 1.00
R1941:Kank2 UTSW 9 21772866 missense possibly damaging 0.69
R1976:Kank2 UTSW 9 21794561 missense probably damaging 0.97
R2276:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2278:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2303:Kank2 UTSW 9 21769765 missense probably benign 0.12
R4163:Kank2 UTSW 9 21795568 missense probably damaging 1.00
R4204:Kank2 UTSW 9 21795627 missense probably damaging 1.00
R4461:Kank2 UTSW 9 21794745 nonsense probably null
R4738:Kank2 UTSW 9 21774619 missense probably damaging 1.00
R4811:Kank2 UTSW 9 21775747 missense probably damaging 1.00
R4859:Kank2 UTSW 9 21779782 missense probably benign 0.13
R5838:Kank2 UTSW 9 21795393 missense probably damaging 0.99
R6449:Kank2 UTSW 9 21780562 missense possibly damaging 0.68
R7131:Kank2 UTSW 9 21794679 missense probably benign 0.02
Z1177:Kank2 UTSW 9 21795249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGAATGCCCAAGTCCC -3'
(R):5'- TTCTACCCACAGTACGGAGC -3'

Sequencing Primer
(F):5'- TCTCTAGTGCAGCAGGGTC -3'
(R):5'- AGCCTTGGAGACCCGAATC -3'
Posted On2015-05-15