Incidental Mutation 'R4085:Olfr1383'
ID317097
Institutional Source Beutler Lab
Gene Symbol Olfr1383
Ensembl Gene ENSMUSG00000107417
Gene Nameolfactory receptor 1383
SynonymsMOR256-56, GA_x6K02T2QP88-5912627-5911692
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4085 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49519648-49527199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49524128 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000145258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077143] [ENSMUST00000204706] [ENSMUST00000213152] [ENSMUST00000213707] [ENSMUST00000213899] [ENSMUST00000217564]
Predicted Effect probably benign
Transcript: ENSMUST00000077143
AA Change: I135T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076390
Gene: ENSMUSG00000107417
AA Change: I135T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204706
AA Change: I135T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145258
Gene: ENSMUSG00000107417
AA Change: I135T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213152
Predicted Effect probably benign
Transcript: ENSMUST00000213707
Predicted Effect probably benign
Transcript: ENSMUST00000213899
Predicted Effect probably benign
Transcript: ENSMUST00000217564
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Olfr1383
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:Olfr1383 APN 11 49523744 missense possibly damaging 0.56
IGL03178:Olfr1383 APN 11 49523990 missense possibly damaging 0.90
R0089:Olfr1383 UTSW 11 49524206 missense possibly damaging 0.67
R0112:Olfr1383 UTSW 11 49524134 missense possibly damaging 0.70
R0243:Olfr1383 UTSW 11 49523912 missense probably damaging 1.00
R0445:Olfr1383 UTSW 11 49523957 missense probably damaging 1.00
R0646:Olfr1383 UTSW 11 49524578 missense probably damaging 1.00
R1695:Olfr1383 UTSW 11 49524335 missense probably benign 0.32
R2142:Olfr1383 UTSW 11 49523839 missense probably benign 0.00
R3898:Olfr1383 UTSW 11 49524559 missense probably damaging 0.98
R5677:Olfr1383 UTSW 11 49523944 missense probably damaging 0.98
R6187:Olfr1383 UTSW 11 49523511 unclassified probably benign
R6272:Olfr1383 UTSW 11 49524126 missense possibly damaging 0.67
R6287:Olfr1383 UTSW 11 49524245 missense probably damaging 0.99
R6898:Olfr1383 UTSW 11 49523709 unclassified probably benign
R7007:Olfr1383 UTSW 11 49524184 missense probably benign 0.15
R7452:Olfr1383 UTSW 11 49524381 missense probably benign 0.03
R7699:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
R7700:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
X0017:Olfr1383 UTSW 11 49524002 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACGAATGGATCAGCGACTAC -3'
(R):5'- TGTCCTCACAAGCCAGCTTC -3'

Sequencing Primer
(F):5'- TCTGCTACACCACCAGCATTG -3'
(R):5'- GCTTCAGGAGAACAAGCATCTC -3'
Posted On2015-05-15