Incidental Mutation 'R4085:Mef2c'
ID317104
Institutional Source Beutler Lab
Gene Symbol Mef2c
Ensembl Gene ENSMUSG00000005583
Gene Namemyocyte enhancer factor 2C
Synonyms9930028G15Rik, 5430401D19Rik
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location83504034-83667080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83575702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 9 (T9M)
Ref Sequence ENSEMBL: ENSMUSP00000142456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005722] [ENSMUST00000163888] [ENSMUST00000185052] [ENSMUST00000195904] [ENSMUST00000195984] [ENSMUST00000196207] [ENSMUST00000196493] [ENSMUST00000196730] [ENSMUST00000197146] [ENSMUST00000197681] [ENSMUST00000197722] [ENSMUST00000197938] [ENSMUST00000198064] [ENSMUST00000198069] [ENSMUST00000198199] [ENSMUST00000198217] [ENSMUST00000198916] [ENSMUST00000199019] [ENSMUST00000199105] [ENSMUST00000199167] [ENSMUST00000199210] [ENSMUST00000199432] [ENSMUST00000199450] [ENSMUST00000200394] [ENSMUST00000200123]
Predicted Effect probably benign
Transcript: ENSMUST00000005722
AA Change: T9M

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005722
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 5.3e-27 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163888
AA Change: T9M

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132547
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 155 1.4e-17 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185052
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138826
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 154 6e-27 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 418 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195904
AA Change: T9M

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143339
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 5.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195984
AA Change: T9M

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143611
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 2.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196207
AA Change: T9M

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143221
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 120 2.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196493
AA Change: T9M

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142897
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196730
AA Change: T9M

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143338
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 4.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197022
Predicted Effect possibly damaging
Transcript: ENSMUST00000197146
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143227
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197681
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143420
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 9.5e-15 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197722
AA Change: T9M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142456
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 2.8e-12 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197938
AA Change: T9M

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143187
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198064
AA Change: T9M

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142399
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198069
AA Change: T9M

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143286
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000198199
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143742
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 153 2e-23 PFAM
low complexity region 314 324 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198217
AA Change: T9M

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142487
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 268 278 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198916
AA Change: T9M

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000199019
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143401
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199105
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143212
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 1.1e-14 PFAM
low complexity region 324 334 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199167
AA Change: T9M

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142884
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 154 6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199210
AA Change: T9M

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142595
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
low complexity region 276 286 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199262
Predicted Effect possibly damaging
Transcript: ENSMUST00000199432
AA Change: T9M

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142714
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 156 3.1e-12 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199450
AA Change: T9M

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143315
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 3.29e-37 SMART
Pfam:HJURP_C 90 156 5.1e-15 PFAM
low complexity region 316 326 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200394
AA Change: T9M

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143598
Gene: ENSMUSG00000005583
AA Change: T9M

DomainStartEndE-ValueType
MADS 1 60 1.1e-39 SMART
Pfam:HJURP_C 90 155 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200123
Meta Mutation Damage Score 0.5679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have cardiovascular abnormalities and die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Mef2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Mef2c APN 13 83625380 missense probably damaging 1.00
IGL01012:Mef2c APN 13 83655595 missense probably damaging 1.00
IGL03131:Mef2c APN 13 83662375 missense probably damaging 1.00
IGL03186:Mef2c APN 13 83652868 missense probably benign 0.03
LCD18:Mef2c UTSW 13 83605823 intron probably benign
R0021:Mef2c UTSW 13 83656240 missense probably damaging 1.00
R0062:Mef2c UTSW 13 83652873 missense possibly damaging 0.65
R0480:Mef2c UTSW 13 83592901 missense probably damaging 1.00
R0755:Mef2c UTSW 13 83656353 critical splice donor site probably null
R1290:Mef2c UTSW 13 83662359 missense probably benign 0.19
R4734:Mef2c UTSW 13 83662629 makesense probably null
R5230:Mef2c UTSW 13 83652907 missense possibly damaging 0.89
R5385:Mef2c UTSW 13 83662413 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6032:Mef2c UTSW 13 83662359 missense probably benign 0.19
R6258:Mef2c UTSW 13 83652938 missense probably damaging 1.00
R6670:Mef2c UTSW 13 83662597 missense probably damaging 1.00
R6672:Mef2c UTSW 13 83652856 missense probably damaging 1.00
R6702:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6703:Mef2c UTSW 13 83625406 missense possibly damaging 0.70
R6881:Mef2c UTSW 13 83592942 missense probably damaging 1.00
R6907:Mef2c UTSW 13 83654611 missense probably benign 0.32
R7503:Mef2c UTSW 13 83662504 missense possibly damaging 0.80
R8168:Mef2c UTSW 13 83656350 missense probably damaging 0.99
Z1177:Mef2c UTSW 13 83625266 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTCAGCAGGAACGAATGCAG -3'
(R):5'- CACTTAAAGGTCTCGAGGCAGTG -3'

Sequencing Primer
(F):5'- CAGGGATTTGGGAACTGAGCTG -3'
(R):5'- TCTCGAGGCAGTGGAAAGTG -3'
Posted On2015-05-15