Incidental Mutation 'R4085:Ddx4'
ID317105
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission 040979-MU
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112613761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 386 (V386A)
Ref Sequence ENSEMBL: ENSMUSP00000075157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: V386A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: V386A

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: V412A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: V412A

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112621276 missense probably benign 0.08
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
R7822:Ddx4 UTSW 13 112612113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCGTTTTGTTTCCACAAG -3'
(R):5'- GCAAACAGGTTGAGTCTTGTCC -3'

Sequencing Primer
(F):5'- GGAAAATGCTATTATCCTGTGCG -3'
(R):5'- GTGTAAGAGCTGTGGTCAT -3'
Posted On2015-05-15