Incidental Mutation 'R4085:Ppp3cb'
ID 317106
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Name protein phosphatase 3, catalytic subunit, beta isoform
Synonyms Cnab, CnAbeta, 1110063J16Rik, Calnb, PP2BA beta
MMRRC Submission 040979-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4085 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 20549432-20596641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20558611 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 484 (C484R)
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
AlphaFold P48453
Predicted Effect probably benign
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161989
AA Change: C484R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: C484R

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162217
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Abca15 T C 7: 119,981,949 (GRCm39) V1088A probably damaging Het
Adgrl3 A G 5: 81,660,391 (GRCm39) I319V probably benign Het
Atraid A T 5: 31,209,650 (GRCm39) probably benign Het
Aurkaip1 A T 4: 155,917,362 (GRCm39) K172N probably benign Het
Bicd2 T A 13: 49,538,438 (GRCm39) probably null Het
Ccr1 C T 9: 123,763,987 (GRCm39) R181H probably benign Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Cldn34c4 A T X: 126,629,011 (GRCm39) V153E probably damaging Het
Col4a4 C A 1: 82,448,909 (GRCm39) probably null Het
Coro1b T C 19: 4,203,618 (GRCm39) V451A probably benign Het
Dcc T A 18: 71,959,240 (GRCm39) Q177H probably benign Het
Ddx4 A G 13: 112,750,295 (GRCm39) V386A probably benign Het
Dynlrb1 G T 2: 155,091,896 (GRCm39) probably benign Het
Ehbp1 A T 11: 22,045,898 (GRCm39) L592Q possibly damaging Het
Fam20b T C 1: 156,533,445 (GRCm39) D57G probably benign Het
Fbxo33 A G 12: 59,247,591 (GRCm39) probably benign Het
Fndc4 A G 5: 31,451,121 (GRCm39) I190T probably damaging Het
Gad1 G T 2: 70,420,192 (GRCm39) A359S probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm43517 A G 12: 49,437,897 (GRCm39) probably benign Het
Hectd1 A T 12: 51,821,533 (GRCm39) V1052D possibly damaging Het
Herc6 G A 6: 57,624,054 (GRCm39) C608Y probably benign Het
Itpr2 T A 6: 146,045,746 (GRCm39) D2573V probably damaging Het
Kank2 A G 9: 21,706,415 (GRCm39) L201P probably damaging Het
Kdm1a A C 4: 136,279,273 (GRCm39) Y762* probably null Het
Mef2c C T 13: 83,723,821 (GRCm39) T9M probably damaging Het
Ndst4 A G 3: 125,403,131 (GRCm39) I413V probably benign Het
Nlrp1b T C 11: 71,052,588 (GRCm39) T947A probably damaging Het
Nlrp5 C A 7: 23,129,523 (GRCm39) N863K probably damaging Het
Opn1sw A G 6: 29,380,143 (GRCm39) I91T possibly damaging Het
Or2y13 T C 11: 49,414,955 (GRCm39) I135T probably benign Het
Pmfbp1 A G 8: 110,221,579 (GRCm39) K15E possibly damaging Het
Rassf2 C A 2: 131,846,299 (GRCm39) G153C probably damaging Het
Rbm15b T C 9: 106,762,936 (GRCm39) N411D possibly damaging Het
Rbm47 A G 5: 66,180,080 (GRCm39) M409T probably benign Het
Sall1 C T 8: 89,755,137 (GRCm39) V1281M probably benign Het
Sall3 A T 18: 81,015,348 (GRCm39) M860K probably damaging Het
Sik2 A T 9: 50,846,685 (GRCm39) probably benign Het
Sim2 A G 16: 93,910,213 (GRCm39) Y205C possibly damaging Het
Styxl1 G A 5: 135,788,019 (GRCm39) T92I unknown Het
Sypl2 A G 3: 108,124,992 (GRCm39) I123T possibly damaging Het
Taok2 T C 7: 126,473,897 (GRCm39) E403G possibly damaging Het
Tedc2 A T 17: 24,438,813 (GRCm39) V168E probably benign Het
Tle6 A G 10: 81,430,349 (GRCm39) probably null Het
Traf3ip3 A G 1: 192,863,628 (GRCm39) V414A probably damaging Het
Trim14 T A 4: 46,523,709 (GRCm39) T110S probably benign Het
Ucp1 T C 8: 84,020,580 (GRCm39) I130T probably benign Het
Urb2 A G 8: 124,757,680 (GRCm39) H1129R probably benign Het
Vmn2r111 C T 17: 22,778,096 (GRCm39) G528R probably benign Het
Wbp2nl A G 15: 82,192,762 (GRCm39) M149V probably benign Het
Xdh A T 17: 74,223,874 (GRCm39) M506K probably benign Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20,578,318 (GRCm39) missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20,581,754 (GRCm39) missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20,559,517 (GRCm39) missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20,581,726 (GRCm39) critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20,551,622 (GRCm39) missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20,581,021 (GRCm39) missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20,573,645 (GRCm39) splice site probably null
IGL02944:Ppp3cb APN 14 20,578,303 (GRCm39) missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20,581,793 (GRCm39) missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20,574,052 (GRCm39) missense probably damaging 0.99
Copacabana UTSW 14 20,581,010 (GRCm39) critical splice donor site probably null
eden_express UTSW 14 20,578,263 (GRCm39) nonsense probably null
everglades UTSW 14 20,581,016 (GRCm39) missense probably damaging 1.00
Havana UTSW 14 20,581,820 (GRCm39) missense possibly damaging 0.85
justinian UTSW 14 20,558,611 (GRCm39) missense possibly damaging 0.73
Prokopios UTSW 14 20,570,720 (GRCm39) missense probably benign 0.05
Redwood UTSW 14 20,559,508 (GRCm39) missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20,581,836 (GRCm39) missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20,581,820 (GRCm39) missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20,581,820 (GRCm39) missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20,574,044 (GRCm39) missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20,553,309 (GRCm39) splice site probably null
R1013:Ppp3cb UTSW 14 20,574,072 (GRCm39) missense probably benign
R1061:Ppp3cb UTSW 14 20,558,682 (GRCm39) splice site probably null
R1498:Ppp3cb UTSW 14 20,559,567 (GRCm39) critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20,574,492 (GRCm39) missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20,574,131 (GRCm39) missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20,574,540 (GRCm39) missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20,573,913 (GRCm39) missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20,558,746 (GRCm39) missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20,570,720 (GRCm39) missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20,573,921 (GRCm39) nonsense probably null
R3726:Ppp3cb UTSW 14 20,581,010 (GRCm39) critical splice donor site probably null
R4328:Ppp3cb UTSW 14 20,581,016 (GRCm39) missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20,565,569 (GRCm39) intron probably benign
R4600:Ppp3cb UTSW 14 20,570,714 (GRCm39) missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20,570,714 (GRCm39) missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20,570,714 (GRCm39) missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20,570,714 (GRCm39) missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20,570,714 (GRCm39) missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20,551,583 (GRCm39) missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20,574,130 (GRCm39) missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20,573,911 (GRCm39) missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20,559,508 (GRCm39) missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20,559,490 (GRCm39) missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20,578,263 (GRCm39) nonsense probably null
R5586:Ppp3cb UTSW 14 20,570,758 (GRCm39) splice site probably benign
R5740:Ppp3cb UTSW 14 20,551,664 (GRCm39) missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20,581,094 (GRCm39) missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20,573,719 (GRCm39) missense probably benign 0.00
R7493:Ppp3cb UTSW 14 20,558,619 (GRCm39) missense probably benign 0.01
R8291:Ppp3cb UTSW 14 20,573,662 (GRCm39) missense possibly damaging 0.89
R8438:Ppp3cb UTSW 14 20,565,658 (GRCm39) missense probably damaging 0.99
R8515:Ppp3cb UTSW 14 20,581,844 (GRCm39) missense probably benign 0.21
R8867:Ppp3cb UTSW 14 20,596,517 (GRCm39) unclassified probably benign
R9136:Ppp3cb UTSW 14 20,581,867 (GRCm39) missense probably benign 0.33
R9254:Ppp3cb UTSW 14 20,581,874 (GRCm39) missense probably benign
R9379:Ppp3cb UTSW 14 20,581,874 (GRCm39) missense probably benign
R9516:Ppp3cb UTSW 14 20,573,868 (GRCm39) missense probably damaging 1.00
R9670:Ppp3cb UTSW 14 20,578,314 (GRCm39) missense probably damaging 1.00
Z1177:Ppp3cb UTSW 14 20,558,586 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTGACTGAGGCTTTTGAAAGAAAGG -3'
(R):5'- AAAGCGTGCTGACACTCAAG -3'

Sequencing Primer
(F):5'- GGAATTATGACATGAGCTGCTCCC -3'
(R):5'- TGACACTCAAGGGCCTGACTC -3'
Posted On 2015-05-15