Incidental Mutation 'R4085:Coro1b'
ID317114
Institutional Source Beutler Lab
Gene Symbol Coro1b
Ensembl Gene ENSMUSG00000024835
Gene Namecoronin, actin binding protein 1B
Synonymscoronin 2
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4148619-4154035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4153619 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 451 (V451A)
Ref Sequence ENSEMBL: ENSMUSP00000008893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000025749] [ENSMUST00000061086] [ENSMUST00000118483] [ENSMUST00000123874] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431]
Predicted Effect probably benign
Transcript: ENSMUST00000008893
AA Change: V451A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835
AA Change: V451A

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061086
SMART Domains Protein: ENSMUSP00000053412
Gene: ENSMUSG00000045826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Pfam:PTPRCAP 58 197 8.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123874
SMART Domains Protein: ENSMUSP00000118450
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the coronin family, such as CORO1B, are WD repeat-containing actin-binding proteins that regulate cell motility (Cai et al., 2005 [PubMed 16027158]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Styxl1 G A 5: 135,759,165 T92I unknown Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Coro1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02986:Coro1b APN 19 4149471 missense possibly damaging 0.93
IGL03411:Coro1b APN 19 4150226 splice site probably benign
R0189:Coro1b UTSW 19 4153251 missense probably damaging 1.00
R0410:Coro1b UTSW 19 4149363 missense probably damaging 1.00
R1165:Coro1b UTSW 19 4149902 missense probably damaging 0.99
R1302:Coro1b UTSW 19 4149377 missense probably damaging 1.00
R1519:Coro1b UTSW 19 4150584 missense possibly damaging 0.95
R4528:Coro1b UTSW 19 4149981 missense probably benign 0.23
R4692:Coro1b UTSW 19 4149419 missense probably damaging 1.00
R4919:Coro1b UTSW 19 4150710 missense possibly damaging 0.85
R5433:Coro1b UTSW 19 4153450 missense probably benign
R5650:Coro1b UTSW 19 4150611 missense possibly damaging 0.57
R5870:Coro1b UTSW 19 4149385 missense probably damaging 1.00
R6862:Coro1b UTSW 19 4150771 missense probably benign 0.32
R7332:Coro1b UTSW 19 4149357 missense probably benign 0.00
R7511:Coro1b UTSW 19 4152526 missense probably damaging 1.00
R7559:Coro1b UTSW 19 4150221 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTACTGCAGTTACTGATGTC -3'
(R):5'- AGGTGCAAACTGGCTGTGAC -3'

Sequencing Primer
(F):5'- CAGTTACTGATGTCCCCAGTGG -3'
(R):5'- AACTGCCTGGTGTGACCTG -3'
Posted On2015-05-15