Incidental Mutation 'R4096:Oprk1'
ID317116
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 5602811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect probably benign
Transcript: ENSMUST00000027038
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect probably benign
Transcript: ENSMUST00000160339
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160777
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R0295:Oprk1 UTSW 1 5598850 missense possibly damaging 0.78
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R2994:Oprk1 UTSW 1 5602732 missense probably benign 0.00
R3876:Oprk1 UTSW 1 5602661 nonsense probably null
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4475:Oprk1 UTSW 1 5602601 nonsense probably null
R5177:Oprk1 UTSW 1 5602674 missense probably damaging 1.00
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGAAAACTTCAAGCGGTG -3'
(R):5'- GAAATCGGCTTGGCTTCTTTTC -3'

Sequencing Primer
(F):5'- AAACTTCAAGCGGTGTTTTAGGGAC -3'
(R):5'- CCAGGATCTGCTGTGCTCTG -3'
Posted On2015-05-15