Incidental Mutation 'R4096:Fbxl5'
ID317125
Institutional Source Beutler Lab
Gene Symbol Fbxl5
Ensembl Gene ENSMUSG00000039753
Gene NameF-box and leucine-rich repeat protein 5
SynonymsFbl4, Fir4
MMRRC Submission 041629-MU
Accession Numbers

Genbank: NM_001159963.1, NM_178729.4; Ensemble: ENSMUST00000114047, ENSMUST00000114047, ENSMUST00000119523, ENSMUST00000141902, ENSMUST00000087465, ENSMUST00000121736, ENSMUST00000124610                                     

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43744615-43821638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43758241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 610 (I610V)
Ref Sequence ENSEMBL: ENSMUSP00000084733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000087465] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000121736] [ENSMUST00000124610] [ENSMUST00000196483]
Predicted Effect probably benign
Transcript: ENSMUST00000047857
AA Change: I610V

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753
AA Change: I610V

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000087465
AA Change: I610V

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084733
Gene: ENSMUSG00000039753
AA Change: I610V

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 4.3e-15 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114047
AA Change: I604V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753
AA Change: I604V

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119523
AA Change: I593V

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753
AA Change: I593V

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121736
AA Change: I567V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112444
Gene: ENSMUSG00000039753
AA Change: I567V

DomainStartEndE-ValueType
PDB:3V5Z|B 1 118 2e-71 PDB
FBOX 165 205 2.31e-9 SMART
low complexity region 246 267 N/A INTRINSIC
LRR 312 336 2.43e2 SMART
LRR 339 364 4.87e-4 SMART
low complexity region 438 449 N/A INTRINSIC
LRR 553 578 1.23e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124421
Predicted Effect probably benign
Transcript: ENSMUST00000124610
AA Change: I610V

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116720
Gene: ENSMUSG00000039753
AA Change: I610V

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 5.7e-12 PFAM
FBOX 208 248 1.5e-11 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 1e0 SMART
LRR 382 407 2e-6 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1e-2 SMART
LRR 624 649 1.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140469
Predicted Effect unknown
Transcript: ENSMUST00000141902
AA Change: I530V
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753
AA Change: I530V

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143316
Predicted Effect probably benign
Transcript: ENSMUST00000196483
AA Change: I609V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753
AA Change: I609V

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196543
Meta Mutation Damage Score 0.1518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before turning of the embryo with iron overload, growth retardation, and hemorrhage. Mice heterozygous for a knock-out allele exhibit abnormal iron homeostasis when fed a low iron diet. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Fbxl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fbxl5 APN 5 43765336 missense probably damaging 1.00
IGL00797:Fbxl5 APN 5 43758401 missense probably damaging 1.00
IGL00811:Fbxl5 APN 5 43758225 missense probably damaging 1.00
IGL01065:Fbxl5 APN 5 43745334 missense probably damaging 1.00
IGL01626:Fbxl5 APN 5 43758705 missense probably benign 0.00
IGL02285:Fbxl5 APN 5 43765348 missense possibly damaging 0.88
D3080:Fbxl5 UTSW 5 43758366 missense probably benign 0.00
PIT4498001:Fbxl5 UTSW 5 43750981 missense possibly damaging 0.73
R0195:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R0647:Fbxl5 UTSW 5 43768069 missense probably damaging 0.98
R1540:Fbxl5 UTSW 5 43758636 missense possibly damaging 0.92
R1545:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R1569:Fbxl5 UTSW 5 43765461 missense probably damaging 1.00
R1921:Fbxl5 UTSW 5 43765490 missense probably benign 0.16
R3081:Fbxl5 UTSW 5 43750880 missense probably damaging 1.00
R3776:Fbxl5 UTSW 5 43758276 missense possibly damaging 0.57
R4275:Fbxl5 UTSW 5 43762772 intron probably benign
R4383:Fbxl5 UTSW 5 43762963 intron probably benign
R4469:Fbxl5 UTSW 5 43768186 missense probably damaging 1.00
R4654:Fbxl5 UTSW 5 43765429 missense probably damaging 0.99
R5067:Fbxl5 UTSW 5 43758772 missense probably benign 0.00
R5093:Fbxl5 UTSW 5 43773554 missense probably damaging 1.00
R5696:Fbxl5 UTSW 5 43758840 missense possibly damaging 0.93
R5738:Fbxl5 UTSW 5 43762828 missense probably benign 0.30
R6029:Fbxl5 UTSW 5 43765404 missense probably damaging 0.96
R6185:Fbxl5 UTSW 5 43821552 missense probably benign 0.02
R6842:Fbxl5 UTSW 5 43773586 missense probably damaging 1.00
R7234:Fbxl5 UTSW 5 43758220 missense probably benign 0.08
R7563:Fbxl5 UTSW 5 43821549 missense probably benign 0.00
R7653:Fbxl5 UTSW 5 43758774 missense probably benign
R7842:Fbxl5 UTSW 5 43758603 missense probably damaging 1.00
R7860:Fbxl5 UTSW 5 43758676 missense probably benign 0.00
R8139:Fbxl5 UTSW 5 43758745 nonsense probably null
R8393:Fbxl5 UTSW 5 43768091 missense possibly damaging 0.94
R8727:Fbxl5 UTSW 5 43751020 splice site probably benign
RF012:Fbxl5 UTSW 5 43773505 missense probably damaging 1.00
X0065:Fbxl5 UTSW 5 43760798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATGTTGGTATCAGAAGCAC -3'
(R):5'- TCTGTTGGCAGCAGCATTG -3'

Sequencing Primer
(F):5'- GTTGGTATCAGAAGCACTATTACTCC -3'
(R):5'- CATTCATTCTGTTGTACAGGGACAGC -3'
Posted On2015-05-15