Incidental Mutation 'R4096:Sbno1'
ID317129
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 124391920 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196329] [ENSMUST00000196644] [ENSMUST00000199808] [ENSMUST00000200474]
Predicted Effect probably null
Transcript: ENSMUST00000065263
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168651
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196329
SMART Domains Protein: ENSMUSP00000143084
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Pfam:AAA_34 217 525 1.4e-139 PFAM
Pfam:ResIII 254 441 2.4e-8 PFAM
low complexity region 598 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196644
SMART Domains Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 4.3e-136 PFAM
Pfam:ResIII 289 476 1.8e-6 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199245
Predicted Effect probably null
Transcript: ENSMUST00000199808
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200474
SMART Domains Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:AAA_34 218 523 2.3e-141 PFAM
Pfam:ResIII 251 442 3.3e-7 PFAM
low complexity region 597 613 N/A INTRINSIC
low complexity region 691 712 N/A INTRINSIC
low complexity region 743 755 N/A INTRINSIC
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 splice site probably null
R2149:Sbno1 UTSW 5 124402119 splice site probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
R7535:Sbno1 UTSW 5 124413279 missense possibly damaging 0.48
R7673:Sbno1 UTSW 5 124413216 missense probably benign
R7692:Sbno1 UTSW 5 124405646 missense probably benign 0.35
R7745:Sbno1 UTSW 5 124392899 missense probably benign 0.00
R7762:Sbno1 UTSW 5 124374666 missense probably benign 0.19
R8012:Sbno1 UTSW 5 124384502 missense probably benign 0.43
R8142:Sbno1 UTSW 5 124408545 missense probably benign
R8164:Sbno1 UTSW 5 124374621 missense probably benign 0.13
R8259:Sbno1 UTSW 5 124381696 missense probably damaging 0.99
R8289:Sbno1 UTSW 5 124404005 missense probably damaging 1.00
R8717:Sbno1 UTSW 5 124374555 missense possibly damaging 0.85
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTCAAAGGTTCTCACGCAC -3'
(R):5'- GTCACATCCGTGTTTCATGC -3'

Sequencing Primer
(F):5'- GTTCAAAGGTTCTCACGCACAATAC -3'
(R):5'- ATGCTCCCAGCCAATTTTCTTAAAAC -3'
Posted On2015-05-15