Incidental Mutation 'R4096:Mad1l1'
ID317130
Institutional Source Beutler Lab
Gene Symbol Mad1l1
Ensembl Gene ENSMUSG00000029554
Gene NameMAD1 mitotic arrest deficient 1-like 1
SynonymsMad1
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4096 (G1)
Quality Score185
Status Validated
Chromosome5
Chromosomal Location140008689-140321552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140307673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 130 (R130H)
Ref Sequence ENSEMBL: ENSMUSP00000106453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]
Predicted Effect probably benign
Transcript: ENSMUST00000031534
AA Change: R130H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: R130H

DomainStartEndE-ValueType
Pfam:MAD 54 715 1.6e-272 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110829
AA Change: R130H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: R130H

DomainStartEndE-ValueType
Pfam:MAD 2 511 2.5e-198 PFAM
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr1023 T C 2: 85,887,423 S208P probably damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Mad1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Mad1l1 APN 5 140117277 missense probably benign 0.00
IGL02098:Mad1l1 APN 5 140310589 splice site probably benign
IGL02100:Mad1l1 APN 5 140143934 missense probably damaging 1.00
IGL03131:Mad1l1 APN 5 140307703 missense probably benign 0.18
R0738:Mad1l1 UTSW 5 140300560 missense probably damaging 1.00
R1902:Mad1l1 UTSW 5 140303688 missense possibly damaging 0.57
R1989:Mad1l1 UTSW 5 140303670 missense probably benign 0.27
R2090:Mad1l1 UTSW 5 140009256 missense probably benign 0.01
R2471:Mad1l1 UTSW 5 140261552 missense probably benign 0.43
R4049:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4050:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4682:Mad1l1 UTSW 5 140300252 missense possibly damaging 0.47
R4729:Mad1l1 UTSW 5 140261511 missense possibly damaging 0.76
R4838:Mad1l1 UTSW 5 140300262 nonsense probably null
R5946:Mad1l1 UTSW 5 140261579 missense probably damaging 1.00
R6088:Mad1l1 UTSW 5 140193963 missense probably benign 0.13
R6362:Mad1l1 UTSW 5 140315055 missense possibly damaging 0.71
R6845:Mad1l1 UTSW 5 140009169 missense probably damaging 1.00
R6957:Mad1l1 UTSW 5 140065817 missense probably damaging 0.99
R6983:Mad1l1 UTSW 5 140193984 missense probably damaging 0.99
R7347:Mad1l1 UTSW 5 140144044 missense probably damaging 1.00
U24488:Mad1l1 UTSW 5 140315085 missense probably damaging 1.00
X0026:Mad1l1 UTSW 5 140009205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGGGTACATGCACTCTTC -3'
(R):5'- CAAATCCCTCAGAGTGGGAG -3'

Sequencing Primer
(F):5'- GGGTACATGCACTCTTCTTAGAAAAC -3'
(R):5'- TGGTATCCGGGTCTCCTGC -3'
Posted On2015-05-15